Commit 6fdccf1e authored by flothoni's avatar flothoni Committed by Mathieu Giraud
Browse files

ikaros: add 15 sequences given from Debré hospital into should-get tests

parent 6bd23d9d
......@@ -6,3 +6,50 @@ CAtACACTTCAAGATTATGCATTTATTAACAGATACATGAAATAAATTCCATGTGCATATGCACATATGCACACAGAGCG
TGTGAAGGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCggGTGGGCTGACATGCTGGCTCTCTTCCCTGTATGCCGAGACATGCTTGGGATCTCCTAGCTCCACACTCTGTCTCTCATGAGTCTGAGCCCTTTGGGTTTCTGTGACTTCCAGTCCCC
>del2-8__jonction_intron1_3UTR
CAACAAGTGACCCATCCTTTGAAGCTTACAAGAAGAGAAACATTAATCTATTTCACGTCTTGAAAACAGATCAGTTTTATTTTGCTCAAAAAGGGCACATGTACATTTTTGATCTAGGTCTTAGAAACGTAGAGTTTCAGttctaaGGCTGACATGCTGGCTCTCTTCCCTGTATGCCGAGACATGCTTGGGATCTCCTAGCTCCACACTCTGTCTCTCATGAGTCTGAGCCCTTTGGGTTTCTGTGACTTCCAGTCCCC
#data_patient_debré_19498
>intron_3 2/TT/3 intron_7
AAAAGAACCCTCAGGCATTCAGGAATAAAATGCAAATCACCTTGAAGAAGAAACAGTTACACTAGACTTGATGTTTAAGACGTACTAATAATTTCTGAGATCCCTGGATGCCGTCAATTCAGATTATTTATACCCTATGGGCTGGGAGAAGACCAGAGGGTGTGACGTTCACA
>intron_3 2/GAA/2 intron_7",
AAAGAACCCTCAGGCATTCAGGAATAAAATGCAAATCACCTTGAAGAAGAAACANTTACACTAGACTTGATGTTTCTTCGATGTACTAATAATTTCTGAGATCCCTGGATGCCGTCAATTCAGATTATTTATACCCTATGGGCTGGGAGAAGACCAGAGGG
>intron_3 7/TCGAGG/5 intron_7
AAAGAACCCTCAGGCATTCAGGAATAAAATGCAAATCACCTTGAAGAAGAAACAGTTACACTAGACTTGATGTCCTCGAACTAATAATTTCTGAGATCCCTGGATGCCGTCAATTCAGATTATTTATACCCTATGGGCTGGGAGAAGACCAGAGGGTGTGACGTTCACA
### 13922 - sequences ikfz1 ####
>intron_3 1//2 intron_7 (témoin del4-7)
TGTGAACGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCGAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_1 8/CCCTTC/3 intron_7 (témoin del2-7)
CAACAAGTGACCCATCCTTTGAAGCTTACAAGAAGAGAAACATTAATCTATTTCACGTCTTGAAAACAGATCAGTTTTATTTTGCTCAAAAAGGGCACATGTACATTTTTGATCTAGGTCTTAGAAACGTAGAGTTTCAGAGGATCAGCACCCTTCAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 0/TCGG/6 intron_7 (seq 4-7 du patient)
AAAGAACCCTCAGGCATTCAGGAATAAAATGCAAACCACCTTGAAGAAGAAACAGTTACACTAGACTTGATGCCGAGGGATGTACTAATAATTTCTGAGATCCCTGGATGCCGTCAATTCAGATTATTTATACCCTATGGGCTGGGAGAAGACCAGA
### 17464 - sequences ikfz1 ####
>intron_3 5/GA/2 intron_7 (del4-7 majo)
TGTGAAcGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACgaGAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 1/TC/2 intron_7
TGTGAAcGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCtcGAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 5/CGGGCG/16 intron_7
AAAGAACCCTCAGGCATTCAGGAATAAAATGCAAATCACCTTGAAGAAGAAACAGTTACACTcgcccgGTACTAATAATTTCTGAGATCCCTGGATGCCGTCAATTCAGATTATTTATACCCTATGGGCTGGGAGAAGACCAGAGGGTGTGACgTTCACA
>intron_3 0/C/3 intron_7
TGTGAAcGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACgTCCCcAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 3/GCGG/5 intron_7
TGTGAAcGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATgcggaCATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 1/GGTTAAAG/5 intron_7
TGTGAAcGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCggttaaagACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
### 13444 - sequences ikfz1 ####
>intron_3 1/GCCTCC/2 intron_7 (del4-7 majo 1)
CCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCGCCTCCGAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 0/C/2 intron_7 (del4-7 majo 4)
TGTGAACGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATTCCCGAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 1/TAGG/6 intron_7 (del4-7 majo 3)
TGTGAACGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTACATCCTAGGCATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_3 7/TCGGT/3 intron_7 (del4-7 majo 2)
TGTGAACGTCACACCCTCTGGTCTTCTCCCAGCCCATAGGGTATAAATAATCTGAATTGACGGCATCCAGGGATCTCAGAAATTATTAGTTCGGTAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_1 5//3 intron_7 (del2-7 majo)
CAACAAGTGACCCATCCTTTGAAGCTTACAAGAAGAGAAACATTAATCTATTTCACGTCTTGAAAACAGATCAGTTTTATTTTGCTCAAAAAGGGCACATGTACATTTTTGATCTAGGTCTTAGAAACGTAGAGTTTCAGAGGATCAGCTTAAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
>intron_1 8/CCGA/3 intron_7 (del2-7 mino)
CAACAAGTGACCCATCCTTTGAAGCTTACAAGAAGAGAAACATTAATCTATTTCACGTCTTGAAAACAGATCAGTTTTATTTTGCTCAAAAAGGGCACATGTACATTTTTGATCTAGGTCTTAGAAACGTAGAGTTTCAGAGGATCAGCACCGAAAACATCAAGTCTAGTGTAACTGTTTCTTCTTCAAGGTGATTTGCATTTTATTCCTGAATGCCTGAGGGTTCTTT
\ No newline at end of file
......@@ -5,6 +5,7 @@
$ All sequence have been seen as IKAROS rearangements
8: --IKAROS--
### controle sequence given by Debré ###
# del4-7__jonction_intron3_intron7
$ Find the correct assignation for the sequence intron_3//intron_7
1: intron_3 16/CCCGCG/8 intron_7
......@@ -20,3 +21,55 @@ $ Find the correct assignation for the sequence intron_3//3_UTR
# del2-8__jonction_intron1_3UTR
$ Find the correct assignation for the sequence intron_1//3_UTR
1: intron_1 18/TTCTAA/9 3'UTR_breakpoint1
### cas patient 19498 ###
$ Find the correct assignation for the sequence
1: intron_3 2/TT/3 intron_7
$ Find the correct assignation for the sequence
1: intron_3 2/GAA/2 intron_7
$ Find the correct assignation for the sequence
1: intron_3 7/TCGAGG/5 intron_7
### 13922 - sequences ikfz1 ####
$ Find the correct assignation for the sequence
1: intron_3 1//2 intron_7 (témoin del4-7)
$ Find the correct assignation for the sequence
1: intron_1 8/CCCTTC/3 intron_7 (témoin del2-7)
$ Find the correct assignation for the sequence
1: intron_3 0/TCGG/6 intron_7 (seq 4-7 du patient)
### 17464 - sequences ikfz1 ####
$ Find the correct assignation for the sequence
1: intron_3 5/GA/2 intron_7 (del4-7 majo)
$ Find the correct assignation for the sequence
1: intron_3 1/TC/2 intron_7
$ Find the correct assignation for the sequence
1: intron_3 5/CGGGCG/16 intron_7
$ Find the correct assignation for the sequence
1: intron_3 0/C/3 intron_7
$ Find the correct assignation for the sequence
1: intron_3 3/GCGG/5 intron_7
$ Find the correct assignation for the sequence
1: intron_3 1/GGTTAAAG/5 intron_7
### 13444 - sequences ikfz1 ####
$ Find the correct assignation for the sequence
1: intron_3 1/GCCTCC/2 intron_7 (del4-7 majo 1)
$ Find the correct assignation for the sequence
1: intron_3 0/C/2 intron_7 (del4-7 majo 4)
$ Find the correct assignation for the sequence
1: intron_3 1/TAGG/6 intron_7 (del4-7 majo 3)
$ Find the correct assignation for the sequence
1: intron_3 7/TCGGT/3 intron_7 (del4-7 majo 2)
$ Find the correct assignation for the sequence
1: intron_1 5//3 intron_7 (del2-7 majo)
$ Find the correct assignation for the sequence
1: intron_1 8/CCGA/3 intron_7 (del2-7 mino)
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment