Commit 6ec207d2 authored by Mathieu Giraud's avatar Mathieu Giraud

Merge branch 'feature-a/2142-stop-inside-gene' into 'dev'

Resolve "Séquences productives: limiter la recherche de codon stop à l'intérieur du gène"

Closes #2142

See merge request !695
parents c07297e4 221f79db
Pipeline #156981 passed with stage
in 8 seconds
......@@ -1342,8 +1342,11 @@ void FineSegmenter::findCDR3(){
JUNCTIONaa = nuc_to_aa(subsequence(getSequence().sequence, JUNCTIONstart, CDR3start-1))
+ CDR3aa + nuc_to_aa(subsequence(getSequence().sequence, CDR3end+1, JUNCTIONend));
JUNCTIONproductive = (CDR3nuc.length() % 3 == 0) && (! hasInFrameStopCodon(getSequence().sequence, (JUNCTIONstart-1)%3));
string sequence_startV_stopJ = subsequence(getSequence().sequence, box_V->start+1, box_J->end+1);
int frame = (JUNCTIONstart-1 - box_V->start) % 3;
// Reminder: JUNCTIONstart is 1-based
JUNCTIONproductive = (CDR3nuc.length() % 3 == 0) && (!hasInFrameStopCodon(sequence_startV_stopJ, frame));
}
void FineSegmenter::checkWarnings(CloneOutput *clone, bool phony)
......
......@@ -2,8 +2,8 @@
# This synthetic sequence ends after the end of the J gene,
# including a stop codon in all frames in that zone
# end of the J gene @90
>TRGV9*01 0/CAT/0 TRGJP*01 0/17
acctactactgtgccttgtgggaggtgCAT
# end of the J gene @89
>TRGV9*01 0/CA/0 TRGJP*01 0/17
acctactactgtgccttgtgggaggtgCA
tgggcaagagttgggcaaaaaaatcaaggtatttggtcccggaacaaagcttatcattacag
cccTAGcTAGcTAGccc
......@@ -5,12 +5,15 @@
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -V $VIDJIL_DIR/germline/homo-sapiens/TRGV.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRGJ.fa $VIDJIL_DATA/productive_stop_after_J.fa
!OUTPUT_FILE: out/productive_stop_after_J.vidjil
$ Clone name
1: "TRGV9.01 0/CA/0 TRGJP.01"
$ Correct number of start positions (no V, but J, cdr3 and junction))
3: "start"
$ Correct stop position of TRGJP*01
1: "stop": 92
1: "stop": 91
$ The sequence is productive
f1: "productive": true
1: "productive": true
......@@ -24,5 +24,5 @@ $ Correct number of stop positions (10-1, no stop positions for J on the second
9: "stop"
$ The two sequences are productive
f2: "productive": true
2: "productive": true
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment