Commit 6e18874d authored by Mathieu Giraud's avatar Mathieu Giraud

tests, should-to-tap.sh: vidjil-algo through an $EXEC variable

parent a84454a2
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 1 -k 4 -w 20 -z 0 -c clones -V $VIDJIL_DATA/toy_V.fa -J $VIDJIL_DATA/toy_J.fa $VIDJIL_DATA/ambiguous_representative.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -k 4 -w 20 -z 0 -c clones -V $VIDJIL_DATA/toy_V.fa -J $VIDJIL_DATA/toy_J.fa $VIDJIL_DATA/ambiguous_representative.fa
$ Short reads properly segmented
1:SEG_+.* -> .* 4
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/test_representatives.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -c clones -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/test_representatives.fa
$ Three clones should be found
1:3 clones
......
!LAUNCH: $VIDJIL_DIR/vidjil -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -A $VIDJIL_DATA/cd-4-19.fa
!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -A $VIDJIL_DATA/cd-4-19.fa
$ Load CD-sorting.fa
1:homo-sapiens/CD-sorting.fa .* 28 sequences
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/cdr3-stopcodon.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/cdr3-stopcodon.fa
!LOG: out/cdr3-stopcodon.vidjil
$ Two identical junctions in JSON
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -E 1.0 -g $VIDJIL_DIR/germline ../should-vdj-tests/Demo-X5.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -3 -E 1.0 -g $VIDJIL_DIR/germline ../should-vdj-tests/Demo-X5.should-vdj.fa
$ Detects a CDR3 on regular V(D)J recombinations
1: IGH SEG.* [{].*[}]
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -t 0 -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -t 0 -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake.fa
$ The KmerSegmenter segments the three chimera reads on PSEUDO_MAX12 germline (-2)
1:unexpected .* -> .* 3
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-D.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-D.fa
$ The KmerSegmenter segments the chimera reads on PSEUDO_MAX12 germline (-2)
f1:unexpected .* -> .* 2
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ-trim.g $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ-trim.g $VIDJIL_DATA/chimera-fake-VJ.fa
# Testing a custom (fake) .g with special parameters for the algorithm
$ The KmerSegmenter segments no read in Y because of the parameter
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ.g $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DATA/chimera-fake-VJ.g $VIDJIL_DATA/chimera-fake-VJ.fa
# Testing a custom (fake) germlines.data
$ Report the species
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-VJ.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DATA/chimera-fake-VJ.fa
$ The KmerSegmenter segments the five chimera reads on PSEUDO_MAX12 germline (-2)
1:unexpected .* -> .* 5
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 100 -A -t 0 -g $VIDJIL_DIR/germline -4 $VIDJIL_DATA/chimera-fake-half.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 100 -A -t 0 -g $VIDJIL_DIR/germline -4 $VIDJIL_DATA/chimera-fake-half.fa
# TODO: a more precise modeling should give a e-value computation that could make this work even with -e 1
$ The KmerSegmenter segments the six chimera reads on PSEUDO_MAX1U germline (-4)
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-fake.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-fake.fa
$ Do not segment on any germline, even incomplete
1:junction detected in 0 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-trg.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -uU -g $VIDJIL_DIR/germline $VIDJIL_DATA/chimera-trg.fa
$ Do not segment on IGL by chance
f1:IGL .* -> .* 0
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -c clones -A -3 $VIDJIL_DATA/segment_lec.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -c clones -A -3 $VIDJIL_DATA/segment_lec.fa
$ Extract 50bp windows (TRG)
1:found . 50-windows
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 1 -r 1 $VIDJIL_DATA/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 1 -r 1 $VIDJIL_DATA/clones_simul.fa
$ Junction extractions
1:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 -n 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -k 14 -w 50 -c clones -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -y 3 -z 0 -r 1 -n 5 $VIDJIL_DATA/clones_simul.fa ; cat out/clones_simul.vidjil
$ Window extractions
2:found 25 50-windows in 66 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -KA -z 0 -s \\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\# -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa $VIDJIL_DATA/common-V-D.fa ; cat out/common-V-D.affects
$ Segments the sequence
1: SEG .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -3 -c segment -g $VIDJIL_DIR/germline/mus-musculus.g $VIDJIL_DATA/example_mouse.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -3 -c segment -g $VIDJIL_DIR/germline/mus-musculus.g $VIDJIL_DATA/example_mouse.fa
$ Segment sequence on IGK
1:segIGK.*IGKV.*IGKJ
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'Command line' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/clones_simul.fa > out-fa ; $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -b clones_simul $VIDJIL_DATA/clones_simul.fa.gz > out-fa-gz ; diff -s -I '\#' -I 'index' -I 'Command line' out-fa out-fa-gz ; echo 'Diff: '\\$?; wc -l out-fa-gz
$ Identical output
1:Diff: 0
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 1 $VIDJIL_DATA/large_N.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 1 $VIDJIL_DATA/large_N.fa
$ Find a huge insertion in the segmentation
1:>clone-001.*/[ACGT]{100}
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
!LAUNCH: (for i in {1..100000}; do echo '>read' ; echo ccgtgtattactgtgcgagagagctgaatacttccagcactg ; done ;) > same-igh-100k.fa ; $LAUNCHER $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5000 -w 15 same-igh-100k.fa; rm -f same-igh-100k.fa
$ Find a unique clone with all reads
1:>clone-001--IGH--0100000--100.--window
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-complete.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-complete.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-complete.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-complete.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-short.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-short.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil -c segment $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH,IGK,IGL $VIDJIL_DATA/multi-complete.fa ; cat out/multi-complete.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC -c segment $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH,IGK,IGL $VIDJIL_DATA/multi-complete.fa ; cat out/multi-complete.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ Segment the Ig recombinations
1:IGH SEG
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 5 -K -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa ; head -n 17 out/multi-short.affects
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 5 -K -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa ; head -n 17 out/multi-short.affects
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRG,TRD,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens-cd.g -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRG,TRD,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa
$ Segment all the seven reads
1:junction detected in 7 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-tiny.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline $VIDJIL_DATA/multi-tiny.fa
$ Do not segment any of the seven reads
7:UNSEG
......
# The sequences are on TRG, no CDR3 should be found with IGH
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DIR/algo/tests/should-vdj-tests/cdr3-indels.should-vdj.fa; cat out/cdr3-indels.should-vdj.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -3 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DIR/algo/tests/should-vdj-tests/cdr3-indels.should-vdj.fa; cat out/cdr3-indels.should-vdj.vidjil
$ No CDR3 should be found
0:TRGV.* [{].*[}]
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline $VIDJIL_DATA/no-cdr3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -3 -g $VIDJIL_DIR/germline $VIDJIL_DATA/no-cdr3.fa
$ No CDR3 should be found
0:seq1.* IGH SEG.* [{].*[}]
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -A $VIDJIL_DATA/overlap-d-j.fa | grep -v web | tail -4 | tr -d '\\\\n' | wc -c
$ Exported sequence has all the bases
1:116
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c clones -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -A $VIDJIL_DATA/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c clones -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG -A $VIDJIL_DATA/segment_lec.fq > /dev/null ; cat out/segment_lec.vidjil
$ Window
1:"id": "GGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCA"
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG ../should-vdj-tests/ext-nucleotides-N.should-vdj.fa
$ Segments on TRG
1: TRG .* -> .* 1
......
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -c segment $VIDJIL_DATA/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -c segment $VIDJIL_DATA/segment_S22.fa | grep '^>' ; cat out/segment_S22.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ First sequence Stanford
# 164 175 195 203
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -v -g $VIDJIL_DIR/germline -c segment $VIDJIL_DATA/segment_simul.fa | grep '^[>#]'
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -v -g $VIDJIL_DIR/germline -c segment $VIDJIL_DATA/segment_simul.fa | grep '^[>#]'
$ First sequence, easy segmentation (no error, few deletions at the windows, small N)
......
......@@ -6,9 +6,9 @@
# other reads. This is what is tested, we first put 10 sequences, then 5 and
# finally just the sequence of interest alone.
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa; \
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 6 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa;\
$VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa; \
$VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 6 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa;\
$VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -d -r 1 -w 60 -z 100 -x 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/buggy-D.fa
$ Three times the same window
3: TGTGCGGGATCTTCGTCCTCTTATCATAATAATGGTTTTTTGGCGGGGGAGTCATGGGGC
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -W ACCGGTATTACT -W CAGCTGCTCCCC -W TGGGCCACTC -W ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DATA/clones_simul.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -W ACCGGTATTACT -W CAGCTGCTCCCC -W TGGGCCACTC -W ATCAACGCTGGCAATGGTAACACTAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATACGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTCTGTATTACTGTGCGAGAGTGCGCAGCAGCTGGTCTGATGCTTTTGATTATCTGG $VIDJIL_DATA/clones_simul.fa
$ ACCGGTATTACT is found (in window and representative and in the command line)
3:ACCGGTATTACT
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -g $VIDJIL_DIR/germline/homo-sapiens-isotypes.g $VIDJIL_DATA/isotypes.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline -g $VIDJIL_DIR/germline/homo-sapiens-isotypes.g $VIDJIL_DATA/isotypes.fa
$ Report the correct species
1: Homo sapiens .9606.
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 -X 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
$ Skip the good number of reads
1:Processing every 131th read
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DATA/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -\# FA -k 16 -z 0 -w 60 -r 5 -o out2 -uuu -U -v -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DATA/Stanford_S22.fasta ; tail out2/Stanford_S22.segmented.vdj.fa ; grep UNSEG out2/Stanford_S22.unsegmented.vdj.fa
# Testing uncommon and debug options
$ verbose (-v)
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-2
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 2 -r 5 -a -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-2
# Testing detailed clone output (-a)
$ Detailed clone output (out/seq/clone.fa-2), germline
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python $VIDJIL_DIR/tools/format_json.py -1
$ Points list
1:"original_names": [".*data//Stanford_S22.fasta", ".*data//Stanford_S22.fasta"]
......
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -t 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
!LAUNCH: ($LAUNCHER $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c germlines -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -t 100 -s '######-######' $VIDJIL_DATA/Stanford_S22.fasta)
$ number of reads and kmers
1:13153 reads, 3020179 kmers
......
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -3 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -3 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -w 60 -r 5 -e 10 -b data $VIDJIL_DATA/Stanford_S22.fasta > /dev/null ; cat out/data.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ From homo-sapiens.g
1:"ref": "http://www.vidjil.org/germlines/germline-.*.tar.gz"
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -k 14 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -g $VIDJIL_DIR/germline/homo-sapiens-cd.g $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 -k 14 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -g $VIDJIL_DIR/germline/homo-sapiens-cd.g $VIDJIL_DATA/Stanford_S22.fasta
!LOG: stanford-k14.log
$ Find the good number of windows in Stanford S22 (contiguous seed 14)
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 2000 -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 2000 -t 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT $VIDJIL_DATA/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 2 reads in the first 2000 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 2 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 100 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 100 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -r 5 -W ACTGTGCGAGAGTTGGAATTAGTAGTGGCTGGCCTGATTCCTGGGGCCAG $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* -W
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 -r 5 -l $VIDJIL_DATA/Stanford_S22.label $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 -r 5 -l $VIDJIL_DATA/Stanford_S22.label $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vidjil
$ Some clone has only one read, bypassing the -r 5 option, and the good label
1: clone-00..*0001-.* my-clone
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -c segment -x 2 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -x 2 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
$ Segments the good number of sequences in Stanford S22
2: >lcl
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -t 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 -t 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -x 100 $VIDJIL_DATA/Stanford_S22.fasta
$ No read segmented as we have no germline because of the -t
1: UNSEG too few V/J -> 100
!REQUIRES: python $VIDJIL_DIR/tools/check_python_version.py
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 100 -r 1 -z 5 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/vidjil-to-fasta.py -o out/S22.fasta out/Stanford_S22.vidjil ;
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 100 -r 1 -z 5 -w 60 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; python $VIDJIL_DIR/tools/vidjil-to-fasta.py -o out/S22.fasta out/Stanford_S22.vidjil ;
!OUTPUT_FILE: out/S22.fasta
$ 5 representative sequences in the FASTA output file
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -y 0 -s '#####-#####' -w 100 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -y 0 -s '#####-#####' -w 100 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa $VIDJIL_DATA/Stanford_S22.fasta
!LOG: stanford-w100.log
$ Find the good number of "too short sequences" for windows of size 100
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -w all -r 1 -y 15 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -w all -r 1 -y 15 -z 0 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
# Testing '-w all' option
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -y 0 -x 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -y 0 -x 100 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta
$ Analyze the good number of sequences in Stanford S22
1: found .* of 100 reads
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 1 -x 10 -y all -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -x 10 -y all -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vdj.fa
# Testing -x/-y/-z options
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -r 1 -x 10 -y 5 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -r 1 -x 10 -y 5 -z 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta ; cat out/Stanford_S22.vdj.fa
# Testing -x/-y/-z options
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -z 0 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -s \\\\#\\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\#\\\\# $VIDJIL_DATA/Stanford_S22.fasta
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -z 0 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -D $VIDJIL_DIR/germline/homo-sapiens/IGHD.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -s \\\\#\\\\#\\\\#\\\\#\\\\#\\\\#-\\\\#\\\\#\\\\#\\\\#\\\\#\\\\# $VIDJIL_DATA/Stanford_S22.fasta
$ Germlines are custom
1: custom germlines
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB $VIDJIL_DATA/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB $VIDJIL_DATA/trb-only-VJ.fa ; cat out/trb-only-VJ.vidjil
$ Segments the read on TRB (the information is given twice, stdout + .vidjil)
2: TRB .* -> .* 1
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:TRD $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment only 2 reads, because we do not look for incomplete recombinations
1:junction detected in 2 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 -A -g $VIDJIL_DIR/germline $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -w 10 -e 10 -A -g $VIDJIL_DIR/germline $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment 5 reads, thanks to -i
1:junction detected in 5 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -e 10 -k 8 -w 20 -V $VIDJIL_DIR/germline/homo-sapiens/TRDV.fa -V $VIDJIL_DIR/germline/homo-sapiens/TRDD2_upstream.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDD3_downstream.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDJ.fa $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -e 10 -k 8 -w 20 -V $VIDJIL_DIR/germline/homo-sapiens/TRDV.fa -V $VIDJIL_DIR/germline/homo-sapiens/TRDD2_upstream.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDD3_downstream.fa -J $VIDJIL_DIR/germline/homo-sapiens/TRDJ.fa $VIDJIL_DATA/trd-dd2-dd3.fa
$ Segment all 8 reads, thanks to TRDD2 and TRDD3
1: junction detected in 8 reads .100..
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -u $VIDJIL_DATA/segmentation-2.fa ; cat ./out///segmentation-2.UNSEG_ambiguous.fa ; cat ./out///segmentation-2.UNSEG_too_few_V_J.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -u $VIDJIL_DATA/segmentation-2.fa ; cat ./out///segmentation-2.UNSEG_ambiguous.fa ; cat ./out///segmentation-2.UNSEG_too_few_V_J.fa
$ The proper unsegmentation cause is given
1: UNSEG too short -> .* 1
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -uuu $VIDJIL_DATA/segmentation-2.fa ; cat out/segmentation-2.unsegmented.vdj.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL -uuu $VIDJIL_DATA/segmentation-2.fa ; cat out/segmentation-2.unsegmented.vdj.fa
$ Only one sequence is segmented, but it is too small for a window (too short w)
1: junction detected in 1 reads
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -f '1, 2, 3, 4, 5'
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -f '1, 2, 3, 4, 5'
!EXIT_CODE: 1
$Check that correct custom cost is used
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/Makefile 2>&1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/Makefile 2>&1
!EXIT_CODE: 1
$ Error, incorrect *.g
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS 2>&1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS 2>&1
!EXIT_CODE: 1
$ Error, no germlines
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 1 -w -10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta 2>&1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 1 -w -10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta 2>&1
!EXIT_CODE: 1
$ Error, too small -w
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -H 2> out-v ; cat out-v
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -H 2> out-v ; cat out-v
$ License
1:Vidjil is free software
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -h 2> out-v ; cat out-v
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -h 2> out-v ; cat out-v
$ License
1:Vidjil is free software
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -x 100 -r 1 -y 1 -z 0 -w 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta 2>&1
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -x 100 -r 1 -y 1 -z 0 -w 10 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/Stanford_S22.fasta 2>&1
!OUTPUT_FILE: out/seq/clone.fa-1
### !EXIT_CODE: 1
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa
$ Warning, -A
1:WARNING
......
!NO_LAUNCHER:
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 200 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/trd-dd2-dd3.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 200 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/trd-dd2-dd3.fa
$ Warning, -z
1:WARNING
......
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/long-segmentation.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/long-segmentation.fa
$ Sequence should be segmented by k-mer segmenter
e1:SEG_+ -> 1
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/ -r 1 -c clones $VIDJIL_DATA/revcomp-VdJa.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/ -r 1 -c clones $VIDJIL_DATA/revcomp-VdJa.fa
$ Just one window found
1:==> found 1 ..-windows
......
!LAUNCH: $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DATA/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22.log && $LAUNCHER $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DATA/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22_rc.log && diff out/Stanford_S22{,.rc}.vidjil | grep GGG && diff vidjil_s22.log vidjil_s22_rc.log
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DATA/Stanford_S22.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22.log && $LAUNCHER $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -z 1 -k 9 -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH -% 0.001 -r 2 -x 1000 -y 1 -c clones $VIDJIL_DATA/Stanford_S22.rc.fasta | sed 's/--IGH--.*VDJ\\(.*\\).$/\\1/' | sed 's/IGH SEG_./IGH SEG_X/' > vidjil_s22_rc.log && diff out/Stanford_S22{,.rc}.vidjil | grep GGG && diff vidjil_s22.log vidjil_s22_rc.log
!EXIT_CODE: 1
$ Same number segmented
......
......@@ -73,6 +73,7 @@ DIR=$(dirname $file)
BASE=$(basename $file)
cd "$DIR"
EXEC=vidjil-algo
VIDJIL_DIR=../../../
VIDJIL_DEFAULT_OPTIONS=""
VIDJIL_DATA=../data/
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment