Commit 6c9a9b9f authored by Mikaël Salson's avatar Mikaël Salson
Browse files

Merge branch 'feature-c/4606-imgt-subset' into 'dev'

Resolve "IMGt, update paramètres de la requête (V_REGIONsearchIndel, subset)"

Closes #4606

See merge request !921
parents 8c857419 9233ea46
Pipeline #220204 passed with stages
in 86 minutes and 36 seconds
......@@ -84,6 +84,7 @@ function imgtPost(species, data, system) {
imgtInput.sequences = data;
if (system[0] == "I") {
imgtInput.receptorOrLocusType = "IG";
imgtInput.cllSubsetSearch = "true";
}
if (system[0] == "T") {
imgtInput.receptorOrLocusType = "TR";
......
{
"clones": [
{
"germline": "IGH",
"id": "GCAGCCTAAAGGCTGAGGACACCCGACAGGGTATGGACGTCTGGGGCCAA",
"name": "not subset seq; IGHV3-21/IGHJ6*02",
"reads": [
1
],
"sequence": "GGAGTCGGGGCCTGAGGTGAAGAAGCCTGGAGCCTCATTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACAAGCTATGCTATCAGCTGGGTATGACAGGCCCATGGACAAGGGCTTGAGGAAATGGGATGGATCAACACCAACACTGGGAACCTAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCATGGACACCTCCGTCAGCATGGCATATCTTCATATCAGCAGCCTAAAGGCTGAGGACACCCGACAGGGTATGGACGTCTGGGGCCAAGGGACCCTGGTCACCGTCTCCTCAGGT",
"top": 0
},
{
"germline": "IGH",
"id": "subset_2_chimeric",
"name": "Subset2; IGHV3-21/IGHJ6*02",
"reads": [
1
],
"sequence": "GGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAgatTACaatggaatggatgtgTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG",
"top": 2
},
{
"germline": "IGH",
"id": "GTGCACGACGAACTGGATACAGTAGTAGTTGGTACGGAGGAGCAAACTGG",
"name": "subset#8 IGHV4-39*01/IGHJ5*01; unmutated",
"reads": [
1
],
"sequence": "CAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCACGACGAACTGGATACAGTAGTAGTTGGTACGGAGGAGCAAACTGGTTCGACCCATGGGGCCAAGGAACCCTGGTCACCGTCTCCTCAG",
"top": 8
}
],
"germlines": {
"custom": {
"3": [],
"4": [],
"5": [],
"shortcut": "X"
},
"ref": "http://www.vidjil.org/germlines/germline-59.tar.gz",
"species": "Homo sapiens",
"species_taxon_id": 9606
},
"reads": {
"germline": {
"IGH": [
6
],
"IGH+": [
0
],
"IGK": [
0
],
"IGK+": [
0
],
"IGL": [
0
],
"TRA": [
0
],
"TRA+D": [
0
],
"TRB": [
0
],
"TRB+": [
0
],
"TRD": [
0
],
"TRD+": [
0
],
"TRG": [
0
]
},
"segmented": [
6
],
"total": [
6
]
},
"samples": {
"commandline": [
"cmd line"
],
"log": [
"log"
],
"number": 1,
"original_names": [
"test_subset.fasta"
],
"producer": [
"vidjil-algo dev a79706ac2 (2021-02-15)"
],
"run_timestamp": [
"2021-02-16 20:50:19"
]
},
"vidjil_json_version": "2016b"
}
\ No newline at end of file
# coding: utf-8
load 'vidjil_browser.rb'
load 'browser_test.rb'
#browser test suite
class TestImgtSubset < BrowserTest
def setup
super
if not defined? $b
set_browser("/browser/test/data/issues/4606_subset_imgt.vidjil")
end
end
def after_tests
end
### Issue 4606; Add subset search to imgt
def test_00_hide_distrib_clones_with_tagspan
### clone 1; no subset
$b.clone_in_list("0").click
$b.update_icon.wait_while(&:present?)
$b.span(:id => "toIMGT" ).click
assert ( $b.window(:title => "IMGT/V-QUEST").exists? ) , ">> fail opening second IMGT "
$b.window(:title => "IMGT/V-QUEST").use do
assert ($b.text.include? "Number of analysed sequences: 1"), ">> fail IMGT analysis"
assert ($b.text.include? "no rearrangement found (stop codons)"), ">> IMGT expected V not found"
assert ($b.table(:class => "summary_synthesis").ths.last.text.include? "subset"), ">> mention of subset in the table header"
assert (not $b.ul(:id => "warning_list").exists? ), ">> no warning; no mention of subset"
end
$b.window(:title => "").use
$b.window(:title => "IMGT/V-QUEST").close
###
### Clone 2; subset2
$b.clone_in_list("1").click
$b.update_icon.wait_while(&:present?)
$b.span(:id => "toIMGT" ).click
assert ( $b.window(:title => "IMGT/V-QUEST").exists? ) , ">> fail opening second IMGT "
$b.window(:title => "IMGT/V-QUEST").use do
assert ($b.text.include? "Number of analysed sequences: 1"), ">> fail IMGT analysis"
assert ($b.text.include? "Homsap IGHV3-21*01"), ">> IMGT expected V not found"
assert ($b.text.include? "Homsap IGHJ6*02"), ">> IMGT expected J not found"
assert ($b.table(:class => "summary_synthesis").tds.last.text.include? "#2 (a)"), ">> Subset case text have mention of correct subset (#2)"
assert ($b.ul(:id => "warning_list").text.include? "(a) Subset #2 is characterized by the expression of stereotyped B cell receptor immunoglobulin"), ">> return information on subset#2 if detected"
end
$b.window(:title => "").use
$b.window(:title => "IMGT/V-QUEST").close
###
### Clone 3; subset 8
$b.clone_in_list("2").click
$b.update_icon.wait_while(&:present?)
$b.span(:id => "toIMGT" ).click
assert ( $b.window(:title => "IMGT/V-QUEST").exists? ) , ">> fail opening second IMGT "
$b.window(:title => "IMGT/V-QUEST").use do
assert ($b.text.include? "Number of analysed sequences: 1"), ">> fail IMGT analysis"
assert ($b.text.include? "Homsap IGHV4-39*01"), ">> IMGT expected V not found"
assert ($b.text.include? "Homsap IGHJ5*02"), ">> IMGT expected J not found"
assert ($b.table(:class => "summary_synthesis").tds.last.text.include? "#8 (a)"), ">> Subset case text have mention of correct subset (#8)"
assert ($b.ul(:id => "warning_list").text.include? "(a) Subset #8 is characterized by the expression of stereotyped B cell receptor immunoglobulin"), ">> return information on subset#2 if detected"
end
$b.window(:title => "").use
$b.window(:title => "IMGT/V-QUEST").close
###
end
# Not really a test
def test_zz_close
close_everything
end
end
# sh launch_functional_tests $(BROWSERS) functional/issues/test_gra*rb
\ No newline at end of file
......@@ -251,7 +251,7 @@ with other software useful for RepSeq studies.
These buttons open another window/tab.
- [`❯ IMGT/V-QUEST`](http://www.imgt.org/IMGT_vquest):
The reference analysis from IMGT®.
The reference analysis from IMGT®, including subset #2 and #8 search.
The `▼` button further allows to retrieve back results from IMGT/V-QUEST
and to display them within Vidjil.
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment