Commit 6adc587b authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

tools_test.js: Update test after 1e822fe3

The field searched for are not the same anymore, so we adapt the tests.
parent 4aab81d9
......@@ -105,7 +105,7 @@ json_data = {
"JUNCTION frame": "in-frame",
"JUNCTION": "tgtgccacctgggacaggctgaaggattggatcaagacgttt",
"JUNCTION (with frameshift)": "",
"3'V-REGION": "tgtgccacctgggacagg",
"V-REGION": "tgtgccacctgggacagg",
"P3'V": "c",
"N-REGION": "tgaag",
"N1-REGION": "",
......@@ -125,7 +125,7 @@ json_data = {
"P3'D3": "",
"N4-REGION": "",
"P5'J": "",
"5'J-REGION": "gattggatcaagacgttt",
"J-REGION": "gattggatcaagacgttt",
"JUNCTION-nt nb": "42",
"3'V-REGION-nt nb": "18",
"P3'V-nt nb": "1",
......
......@@ -28,7 +28,7 @@ test("Segmenter : ", function() {
equal(document.getElementById("f2"), null, "unselect : Ok")
//
deepEqual(segment.findPotentialField(), ["","m","cdr3","fr1","3'V-REGION","5'J-REGION","D Region","CDR3-IMGT"], "potentialField : Ok")
deepEqual(segment.findPotentialField(), ["","m","cdr3","fr1","V-REGION","J-REGION","D-REGION","CDR3-IMGT"], "potentialField : Ok")
m.select(0)
......
......@@ -61,13 +61,13 @@ asyncTest("processImgtContents", function () {
test("computeStartStop(arrayToProcess,sequence)", function () {
var imgt2displayCheck = {
"3'V-REGION": {
"V-REGION": {
"seq": "",
"tooltip": "Homsap TRGV3*01 F",
"start": 161,
"stop": 178
},
"5'J-REGION": {
"J-REGION": {
"seq": "",
"tooltip": "Homsap TRGJP2*01 F",
"start": 185,
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment