browser/test: Add files for functional testing segmenter page

browser/test/segmenter_browser.rb

+# coding: utf-8
+load 'vidjil_browser.rb'
+
+class SegmenterBrowser < VidjilBrowser
+
+  def sequences_area
+    return element(:id => 'form_sequences')
+  end
+  
+  protected
+  
+  def scatterplot_id
+    return 'scatter_container'
+  end
+
+  def segmenter_id
+    return 'segmenter_container'
+  end
+
+end

browser/test/test_segmenter-page.rb

+load 'segmenter_browser.rb'
+load 'browser_test.rb'
+
+class TestSegmenterPage < BrowserTest
+
+  def set_browser
+    # Redefine set_browser as the tested webpage is totally different
+
+    folder_path = Dir.pwd
+    folder_path.sub! '/browser/test', ''
+    index_path = 'file://' + folder_path + '/browser/segmenter_page.html'
+
+    print "Open browser\n"
+    #$b = VidjilBrowser.new :safari
+    $b = SegmenterBrowser.new :firefox
+    #$b = VidjilBrowser.new :chrome
+
+    print "Resize\n"
+    $b.window.resize_to(1500, 800)
+
+    print "Testing segmenter page at " + index_path + "\n"
+    $b.goto index_path
+
+    # check that the segmenter loaded correctly
+    if not $b.textarea(:id => 'form_sequences').present?
+      print "Loading of segmenter page failed. Do not execute remaining tests."
+      exit
+    end
+
+    print "Segmenter page loaded, launching tests.\n"
+    
+  end
+  
+  def setup
+    super
+    if not defined? $b
+      set_browser
+    end
+  end
+
+  def test_00_launch_query
+    sequences = $b.textarea(:id => 'form_sequences')
+
+    sequences.set ">seq1
+CGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGGGGCCAGATTATAAGAAACTCTTTGGCAGTGGAACAACAC
+
+>seq2
+GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGTGAGGCGGAGAGATCGGGGGATTGTAGTGGTGGTAGCTGCTACTCAACGGTAAGTTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGT"
+
+    assert (not $b.element(:class => 'segmenter').present?), "Segmenter should not be present yet"
+    assert (not $b.element(:class => 'scatterplot').present?), "Segmenter should not be present yet"
+
+    $b.button(:id => 'form_submit').click
+
+    $b.element(:class => 'imgAjaxLoading').wait_until_present
+    $b.clone_in_scatterplot('0').wait_until_present
+    
+    assert ($b.element(:class => 'segmenter').present?), "Segmenter should be present"
+    assert ($b.element(:class => 'scatterplot').present?), "Segmenter should be present"
+  end
+
+  def test_01_segmenter
+    assert ($b.clone_in_segmenter('0').visible?), "Clone 0 should be in segmenter"
+    assert ($b.clone_in_segmenter('1').visible?), "Clone 1 should be in segmenter"
+    assert (not $b.clone_in_segmenter('2').exists?), "Clone 2 should not exist"
+  end
+
+  def test_02_scatterplot
+    assert ($b.clone_in_scatterplot('0').visible?), "Clone 0 should be in scatterplot"
+    assert ($b.clone_in_scatterplot('1').visible?), "Clone 1 should be in scatterplot"
+    assert (not $b.clone_in_scatterplot('2').visible?), "Clone 2 should not be visible"
+  end
+
+  def test_03_change_color
+    $b.clone_in_segmenter('0').hover
+    $b.clone_info_segmenter('0')[:star].click
+    tagColor = $b.tag_item('3')[:color].style('background-color')
+    check_segmenter_on_the_right
+    $b.tag_item('3')[:name].click
+    $b.clone_in_segmenter('1').hover # Change clone to hover: on hover color doesn't change
+
+    assert ($b.clone_info_segmenter('0')[:name].style('color') == tagColor), "Clone has not changed color in segmenter"
+
+    # Must remove rgb from the start of the fill style, and the closing parentheses at the end,
+    # as tagColor is a rgba color with four components, and not just a rgb as the fill color.
+    assert (tagColor.index($b.clone_in_scatterplot('0').style('fill')[4..-2]) > 0), "Clone has not changed color in scatterplot"
+
+    # Check that scatterplot is still on the right
+    check_segmenter_on_the_right
+  end
+
+  def test_04_segmenter_highlights
+    for i in ['0', '1']
+      for gene in ['V', 'J']
+        span = $b.clone_in_segmenter(i).span(:class => gene)
+        assert (span.visible?), "#{gene} span should be visible"
+      end
+    end
+  end
+
+  def test_05_imgt_post
+    begin
+      $b.span(:id => "toIMGTSeg" ).click
+      $b.segmenter_checkbox_imgt_vdj.wait_until_present
+
+      clone_info = $b.clone_info_segmenter('0')
+      productive_html = clone_info[:info].map(&:html)
+      assert (productive_html.grep(/productive/).any?), "IMGT should tell us the productivity of the sequence"
+
+      clone_segmenter = $b.clone_in_segmenter('0')
+      $b.segmenter_checkbox_imgt_vdj.click
+      highlights = clone_segmenter.spans(:class => 'highlight_border')
+      assert (highlights.size >= 2 && highlights.size <= 3), "We should have the V(D)J genes highlighted, we had %d highlights" % highlights.size
+      for h in highlights
+        assert (h.style('width').to_i >= 100), "Highlights should have a reasonable width, found to be %s" % h.style('width')
+      end
+
+      clone_info[:identity].element(:text => "NaN%").wait_while_present
+      assert ((clone_info[:identity].text =~ /^[0-9\.]+%$/) == 0 ), "We should have identity rate (found: %s)" % clone_info[:identity].text
+    end
+  end
+
+  def test_06_scatterplot_change_preset
+    $b.scatterplot_select_preset(/CDR3 length/)
+                                       
+    assert ($b.scatterplot_x_label.text =~ /CDR3 length/), "X scatterplot label should now be CDR3 length (was %s)" % $b.scatterplot_x_label.text
+    sleep 1 # Waiting for the transition to finish
+    assert ($b.clone_in_scatterplot('1').tag_name == 'rect'), "Clone should be a rectangle now (was %s)" % $b.clone_in_scatterplot('1').tag_name
+  end
+
+  def test_07_export_fasta
+    $b.element(:id => 'btn_exportfasta').click
+    
+    assert ( $b.window(:title => "").exists? ) , ">> fail opening fasta export "
+    $b.window(:title => "").use do
+      assert ($b.text.index(/TRGV5.*200 nt/) > 0), "header name"
+      assert ($b.text.index(/IGHV3-13.*374 nt/) > 0), "header name"
+      assert ($b.text.include? "CCTGG\nGGGGCCA\nGATT"), "sequence"
+    end
+  end
+  
+  def check_segmenter_on_the_right
+    
+    right_coord_of_textarea = $b.sequences_area.wd.location.x \
+                              + $b.sequences_area.wd.size.width
+    left_coord_of_scatterplot = $b.scatterplot.wd.location.x
+
+    assert (right_coord_of_textarea < left_coord_of_scatterplot), "Textarea should be left of scatterplot"
+  end
+  
+  def test_zz_close
+    close_everything
+  end
+end