Commit 6935e2ae authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update should_get tests to .data 2014.10 format

parent adad65ef
!LAUNCH: ../../vidjil -G ../../germline/IGH -r 5 -d ../../data/Stanford_S22.fasta ; cat out/vidjil.data | sh format-json.sh
$ Number of reads
1:"reads_total" : [ 13153 ] ,
1:"total" : [ 13153 ] ,
$ Number of segmented reads
1:"reads_segmented" : [ 13139 ] ,
1:"segmented" : [ 13139 ]
$ Most abundant window
1:"window" : "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "size" : [ 8 ]
1:"id" : "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "reads" : [ 8 ]
......@@ -4,7 +4,7 @@ $ Points list
f1:"point": [ "", "" ]
$ Most abundant window, twice, fused
f1:"window": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", "id": .*, "size": [ 8, 8 ]
f1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC", .*"reads": [ 8, 8 ]
# Fails since 49046ca6b97, no more 'others'
$ Windows that are not in the top 50
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment