Commit 69312789 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: chimera sequence on TRG

This sequence should not be segmented on IGL, but reported as AMBIGUOUS on TRG.
parent 44e57047
!LAUNCH: ../../vidjil -A -uU -g ../../germline ../../data/chimera-trg.fa
$ Do not segment on IGL by chance
1:IGL .* 0
$ Report the sequence as AMBIGUOUS
1:UNSEG ambiguous .* 1
>leu-trg-chimera
ATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCCCCGGC
AAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCT
GGTAAGGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTC
CACCGCAAGGGATGTGTTGGAATCAGGACTCAGTCCAGGAAA
GTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGAG
ACTGCAAAATCTAATTGAAAATGATTCTGGG
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment