Commit 6503f6ae authored by Mathieu Giraud's avatar Mathieu Giraud

tests: 4 sequences rev-comped from some existing test sequences

68 sequences are currently passing tests.
Rev-comping these sequences ('python should-vdj-to-tap.py -r'), the tests
fail on these 4 sequences.
parent 51cf9db6
# 0000-nck-TRB.should-vdj.fa.rc
>TRBV7-2*02 0/0/3 TRBJ2-3*01 [TRB]
CCCGCTTACCGAGCACTGTCAGCCGGGTGCCTGGGCCAAAATACTGCGTATCTGTGCTAAAGCTGCTGGCACAGAGATACACGGCCGAGTCCTCCTGCTGTGTGCGCTGGATCGTCAGAGTGGAGACGGATTCCCCAGTCCTCTCTGCAGAGAAGCGATCACTGGGCAGCCCTGATTTGTCTGGTGCACTGTTGCCTTGGAAGTAAATTAAAAACTCCAGGCCCTGCCCCAGCCTCTGCCGGTACCAGTAAAGGGTAA
# 0119-lil-IGK+-TRA+D-TRD+-TRG.should-vdj.fa.rc
>Intron 2/0/9 KDE [IGK+]
CCTCAGAGGTCAGAGCAGGTTGTCCTAGGGAGCAGGGAGGCTTCCTAGGGAGGTCAGACTCCAAATAGTGGATATGGCAAAAATGCAGCTGCAGACTCATGAGGAGTCGCCCTGGGCTGCCACTCAGGAAAGCTGGCTACGGCAGCATCAATCGGGCAGACACAGGGTGGCCACGGCCACTAGCGGCAAGGCGGCTGCCCCAAGAGCGCGGTGGCATGGCCACCAAAGCCACTCAATCGAGAAAGACCGCGGCTCTGTCTACAGCTCGCGGTGCCACG
# 0122-lil-TRG.should-vdj.fa.rc
>TRGV5*01 4/2/5 TRGJP2*01 [TRG]
TTACCAGGCGAAGTTACTATGAGCCTAGTCCCTTTTGCAAACGTCTTGATCCAATCACTCTTCCCAGGTGGCACAGTAATAGACCCCAGAATCATTTTCAATTAGATTTCGTAGTATCAATATCCAGCTCCACCTCCTGGGTGTATGAGTATAATACTTTCCTGGACTGAGTCCTGATTCCAACACATCCTTTGAGTTGGAGACGTCATAGTACAGAAGACGCTGTGGGGCCTTCC
# 0169-lil-TRA+D.should-vdj.fa.rc
>TRDD2*01 13//8 TRAJ29*01 [TRA+D]
GGCAAAAGCATTCTAGGTACACTGAAAAATAATTCAAGGGAAGAAGCCATTGCTGATCAAAATCAAGGATGGCTAGAAACACTTACTTGCAATCACAGAAAGTCTTGTGCCCTTTCCAAAGACAAGAGGTGTCCCTTCCATGAAACACATCAGTATAAAAACCCTCTTCTTCCTTTTTCCCTTTCCTTGGCACTTTGCCATCACCACCCGCT
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment