Une nouvelle version du portail de gestion des comptes externes sera mise en production lundi 09 août. Elle permettra d'allonger la validité d'un compte externe jusqu'à 3 ans. Pour plus de détails sur cette version consulter : https://doc-si.inria.fr/x/FCeS

Commit 62f5c39f authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

should-vdj-tests: BRI_IGK, check all 5 failures

- 3 sequences with 2 conserved nucleotides after a mutation -> alternative solution
- 2 other sequences -> actual bug
parent c2d34887
......@@ -9,7 +9,8 @@ GTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 0732EC
>IGKV2D-30*01 17/AG/0 KDE [IGK]
#15//0 is too permissive
>IGKV2D-30*01 17/AG/0 KDE [IGK] BUG
ACAGTGATGGAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAA
GGTTTCTAACTGGGACTCTGGGGTCCCAGACA
GATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
......@@ -29,7 +30,8 @@ ATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTC
#target 0862PT
>IGKV2-30*01 15/CAC/15 KDE [IGK]
#end of IGKV2-30*01/15 is ...aaggTac
>IGKV2-30*01 (12//15, 15/CAC/15) KDE [IGK]
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGCACGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
......@@ -74,7 +76,8 @@ TTTATTACTGCATGCAAGCTACACAATTTCCTCATGTAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1026TM
>IGKV1-39*01 1/GCGCCTTCTCCAGG/5 KDE [IGK]
#start of KDE/2 is agCcct...
>IGKV1-39*01 (1/GCGCCTTCTCC/2, 1/GCGCCTTCTCCAGG/5) KDE [IGK]
AGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCA
ACTTACTACTGTCAACAGAGTTACAGTACCCCTC
GCGCCTTCTCCAGG
......@@ -91,7 +94,8 @@ GGAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1089IH
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK]
#8/ACT/1 is too permissive
>IGKV2-30*01 8/ACTGAGG/5 KDE [IGK] BUG
GATTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGG
TTTATTACTGCATGCAAGGTACACACACTGAGGCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAG
CTGC
......@@ -107,7 +111,8 @@ GAGCCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGC
#target 1200CT
>IGKV1-17*01 3/CCC/16 KDE [IGK]
#end of IGKV1-17*10 is ...tacccTcc
>IGKV1-17*01 (0//16, 3/CCC/16) KDE [IGK]
GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCT
GAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCC
CCC
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment