Commit 61e52780 authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj: BRI_IGH, alternative N region

Three nucleotides after one insertion and one mutation. This may be dubious.
parent 06754186
......@@ -11,12 +11,13 @@ GCCCTATAGTGAGTCGTATTA
#target 0796TH
>IGHV4-59*01 6/CGTGAGGGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTT/3 IGHD6-6*01 3/0/7 IGHJ4*02 [IGH]
#IGHV4-59*01: ...gtgtattactgtgc gAgagA
>IGHV4-59*01 (6/CGTGAGGGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTT/3, 1/GGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTT/3) IGHD6-6*01 (3/0/7, 2/0/8) IGHJ4*02 [IGH]
AGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGC
TCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATC
TATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAG
AACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGC
CGTGAGGGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTTTATAGCAGCTCGT
cGtGAGgGGGAAGGGCGAGAGGGACCCTAGGTTAAAGGGCTTTATAGCAGCTCGT
GACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTA
AGCCCTATAGTGAGTCGTATTA
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment