Commit 5c7b6c27 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: a sequence in which there should be only one detected D

reported by @Anne
parent 66ea418e
Pipeline #150372 failed with stages
in 33 minutes and 5 seconds
# See #4267
>IGHV4-59*01 2/TGGGGG/4 IGHD3-3*01 6/CCCAGACC/4 IGHJ5*02 400 nt, 57 708 reads (86.19%)
TCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGA
TGGGGGTACGATTTTTGGAGTGGTTATCCCAGACC
CTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment