Commit 5c61a3c2 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update and add tests

parent 7de1d067
Pipeline #229418 failed with stages
in 12 minutes and 42 seconds
!OUTPUT_FILE: out/bug4225-j.affects
!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
!LAUNCH: $VIDJIL_DIR/$EXEC -c windows -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
$ Show name and sequence
1:>igkj1 GTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
$ Display three lines per system
3:TRG
3:IGH\+
$ Find only +k and ? affects before the stretch of _ for all loci
16: seed .*(\+k| \?){28}( _)+$
16:^\#.* (k|\?){28}_+$
16:^\$.* (\+| ){28}( )+$
!OUTPUT_FILE: out/chimera-fake-half.affects
!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline -r 1 -4 -K ../data/chimera-fake-half.fa
!LAUNCH: $VIDJIL_DIR/$EXEC -c windows -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB -r 1 -4 -K ../data/chimera-fake-half.fa
$ Find only 48 +B affects on the TRB and unexpected lines
2:^\#.* (_){40}(B){48}(_){10}
2:^\$.* (\s){40}(\+){48}(\s){10}
$ Find only +B and ? affects on the TRB and unexpected lines
2: seed .* _(\+B| \?){48} _
......@@ -4,7 +4,8 @@ $ Segments the sequence
1: SEG .* -> .* 1
$ Find the good affects for the D segment, including a AMBIGUOUS k-mer, common with V
1:_ _ _ \?.f.f.f.f.f.f _ _ _ _
1:___\?ffffff____
1: \+\+\+\+\+\+
$ The windows found by the KmerSegmenter has a fairly good position
2: 1 163 180 220
!LAUNCH: $VIDJIL_DIR/$EXEC -r 5 -K -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa ; head -n 17 out/multi-short.affects
!OUTPUT_FILE: out/multi-short.affects
!LAUNCH: $VIDJIL_DIR/$EXEC -r 5 -K --first-reads 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
1:TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
1:>TRA.* TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
$ First sequence (TRA), count of k-mers
1:129 .* TRA
$ First sequence (TRA), segmentation
1:>TRA--V1-1.01--J1.01 .* seed TRA SEG_+
$ First sequence (TRA), detection
1:==> TRA--V1-1.01--J1.01 .* seed TRA SEG_+
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u ; grep '#>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa -K -c clones $VIDJIL_DATA/revcomp.fa
!NO_LAUNCHER:
!LAUNCH: grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | sort -u
!LAUNCH: grep '==>' out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment