Commit 57bc9a2c authored by Mathieu Giraud's avatar Mathieu Giraud

tests: '-FaW' combo, extracting reads having a known window

parent 09db6cc4
!LAUNCH: ../../vidjil -w 60 -G ../../germline/IGH -FaW TGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTAC ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 5 reads
$ Tbere are the three IGHV/D/J genes in out/seq/clone.fa-1
3:>IGH
$ There are 5 reads in out/seq/clone.fa-1
5:>lcl
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment