Commit 5522ae2f authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

gosh-igh: typo in sequence

parent 4b1c731a
#1469 vh3(l) #1469 vh3(l)
>IGHV3-30-3*01 0/5/2 IGHD6-13*01 3/0/0 IGHJ3*02 [IGH] # sequence: GAGAGCCCTGTATAGCAGCA
# IGHV3-30-3 GAGAGA |||||||||||
# IGHD6-13 gggtatagcagcagctggtac
>IGHV3-30-3*01 1/5/2 IGHD6-13*01 3/0/0 IGHJ3*02 [IGH]
#1466 vh3 #1466 vh3
>IGHV3-64*01 1/23/7 IGHD1-1*01 3/0/6 IGHJ4*02 [IGH] >IGHV3-64*01 1/23/7 IGHD1-1*01 3/0/6 IGHJ4*02 [IGH]
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment