Commit 54693537 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests: Tag bugged sequences

See previous commit
parent 348ba98b
Pipeline #11503 passed with stages
in 19 minutes and 44 seconds
>TRAV29/DV5*01 3/CACCGAGA/3 TRDD2 1/0/3 TRDD3 0/0/2 TRDJ1 [TRD+] BUG
\ No newline at end of file
# A short Dd1 could also be inserted after the TRDV1
>TRDV1*01 1/C/0 TRDD2*01 2//1 TRDD3*01 1/AGGGT/0 TRDJ1*01 [TRD]
>TRDV1*01 0/0/3 TRDD3 4/11/0 TRDJ1*01 [TRD]
>TRDV1*01 0/0/3 TRDD3 4/11/0 TRDJ1*01 [TRD] BUG
>TRAV29/DV5*01 0/9/0 TRDD3 3/9/2 TRDJ1*01 [TRD]
# IGHD3-9*01 0 .....GTATTACGATATTTTgactggttattataac 31
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+]
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] BUG
......@@ -2,7 +2,7 @@
#target 0746OC
# Both alleles are possible for IGHV. The *01 is slightly longer (2nt)
# but has 2 mutations instead of 1 for the *03.
>(IGHV5-51*01, IGHV5-51*03) 0/TCCGCCCTA/5 IGHD1-26*01 2/A/2 IGHJ3*02 [IGH]
>(IGHV5-51*01, IGHV5-51*03) 0/TCCGCCCTA/5 IGHD1-26*01 2/A/2 IGHJ3*02 [IGH] BUG
#target 0808TD
......@@ -88,7 +88,7 @@ AAGCCCTATAGTGAGTCGTATTA
# IGHV3-11*01 277 GTGTATTACTGTGCGAGAGA.................................. 331
# IGHD5-24*01 .......................gtaGAGATGGCTACAattac...........
# IGHJ6*03 -31 .......................................CTACTACTACTACAT 23
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH]
>IGHV3-11*01 (3/CGAGGGAGC/3, 0/GGGAGC/3) IGHD5-24*01 5/C/7 IGHJ6*03 [IGH] BUG
#target 0889CE
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH]
>IGHV1-3*01 3/GCT/2 IGHD2-15*01 22/CCCCCG/16 IGHJ6*02 [IGH] BUG
......@@ -110,7 +110,7 @@ AAGCCCTATAGTGAGTCGTATTA
#target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH]
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH] BUG
#target 0956LC
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH]
>IGHV6-1*01 5/TCCCGATCGAGG/-6 IGHD3-10*01 -0/AACCT/-4 IGHJ6*02 [IGH] BUG
......@@ -200,7 +200,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 0969JS
>IGHV5-51*03 0/TTGAGAAGGGTTTTT/5 IGHD6-13*01 2/CCC/6 IGHJ4*02 [IGH]
#target 0990CE
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH]
>IGHV3-30*18 4/AAGATTCACCATA/21 IGHD32-21*01 0/GTCGGCCCC/2 IGHD3-22*01 7/CGC/10 IGHJ4*02 [IGH] BUG
#target 1202LH
>IGHV5-51*01 1/GATC/4 IGHD7-27*01 0/TCCCAACATAGA/6 IGHJ6*03 [IGH]
>IGHV5-51*01 1/GATC/4 IGHD7-27*01 0/TCCCAACATAGA/6 IGHJ6*03 [IGH] BUG
......@@ -255,7 +255,7 @@ AGCCCTATAGTGAGTCGTATTA
#target 1202LH
>IGHV3-15*01 13/TTTTCCCC/15 IGHD3-22*01 8/GCCC/4 IGHJ4*02 [IGH]
>IGHV3-15*01 13/TTTTCCCC/15 IGHD3-22*01 8/GCCC/4 IGHJ4*02 [IGH] BUG
# target 1266MN
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+]
>IGHD4-4*01 5/GCACGAGG/5 IGHJ5*02 [IGH+] BUG
......@@ -20,7 +20,7 @@ accctgggccccctctcctcaggt
# target 1297RC
> IGHV3-74*01 1/0/11 IGHD6-6*01 0/CTCAA/12 IGHJ6*02 [IGH]
> IGHV3-74*01 1/0/11 IGHD6-6*01 0/CTCAA/12 IGHJ6*02 [IGH] BUG
# target 1297RC
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D]
>TRDD2*01 1/AATCTGGGATT/0 TRDD3*01 4/AG/24 TRAJ53*01 [TRA+D] BUG
......@@ -58,7 +58,7 @@ AATTACTTGCCCCTC
# target 1321HW
>IGHV3-30*01 7/GGG/18 IGHD2-21*02 1/GGGGG/2 IGHJ5*02 [IGH]
>IGHV3-30*01 7/GGG/18 IGHD2-21*02 1/GGGGG/2 IGHJ5*02 [IGH] BUG
# target 1321HW
>TRDV2*01 4/TACA/1 TRDD3 [TRD+]
# target 1321HW
>TRDV2*01 4/TAC/0 TRDD3 5/TTTT/2 TRAJ9*01 [TRA+D]
>TRDV2*01 4/TAC/0 TRDD3 5/TTTT/2 TRAJ9*01 [TRA+D] BUG
# target 0933KC
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH]
>IGHV3-7*01 0/TGGGGGTAG/4 IGHD2-2*01 3/CGGAC/3 IGHJ5*02 [IGH] BUG
# target 0933KC
#target 0934GO
>IGHV1-NL1*01 0/0/-12 IGHD2-8*02 8/TCCTGTGTGTCCC/8 IGHJ4*02 [IGH]
>IGHV1-NL1*01 0/0/-12 IGHD2-8*02 8/TCCTGTGTGTCCC/8 IGHJ4*02 [IGH] BUG
......@@ -138,7 +138,7 @@ ggccagggaaccctggtcaccgtctcctcagg
#target 0934GO
>IGHV3-30*03 4/AA/7 IGHD3-3*01 13/GCGGGGGCCC/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH]
>IGHV3-30*03 4/AA/7 IGHD3-3*01 13/GCGGGGGCCC/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH] BUG
......@@ -146,7 +146,7 @@ tttgactactggggcccgggaaccctggtcaccgtctcctca
#target 0934GO
>IGHV3-30-3*01 0/CGGGGGCG/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH]
>IGHV3-30-3*01 0/CGGGGGCG/10 IGHD2-8*01 13/ATAAGAGGGTTG/0 IGHJ4*02 [IGH] BUG
#target 0934GO
#target 0934GO
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D]
>TRDV2*01 3/CGGAGG/19 TRAJ48*01 [TRA+D] BUG
#target 1119JC
>IGHV2-26*01 0/GAACCGTCTGGGGA/11 IGHD3-22*01 9/G/8 IGHJ4*02 [IGH]
>IGHV2-26*01 0/GAACCGTCTGGGGA/11 IGHD3-22*01 9/G/8 IGHJ4*02 [IGH] BUG
......@@ -181,7 +181,7 @@ cgtctggggaatggtagtcgtggactactggggccagggaaccctggtcaccgtctcctcaggtaa
#target 1119JC
......@@ -189,7 +189,7 @@ ggggccagggaaccctggtcaccgtctcctcaggtaaa
#target 1119JC
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+]
>IGKV1-5*01 7/GCTTT/5 KDE [IGK+] BUG
......@@ -199,7 +199,7 @@ TATCCACTATT
#target 1119JC
>TRGV2*02 0/CGGG/7 TRGJ1*02 [TRG]
>TRGV2*02 0/CGGG/7 TRGJ1*02 [TRG] BUG
......@@ -221,7 +221,7 @@ TAAGTGTTTCTAGCCA
#target 1119JC
>TRBV6-8*01 0/GAGC/0 TRBD2*01 0/CCT/12 TRBJ2-5*01 [TRB]
>TRBV6-8*01 0/GAGC/0 TRBD2*01 0/CCT/12 TRBJ2-5*01 [TRB] BUG
# 0444-lil-TRA+D
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D]
>TRDV1*01 5//3 TRDD2*01 1//7 TRAJ29*01 [TRA+D] BUG
......@@ -9,13 +9,13 @@ gtattatgattacgtttgggggagttatgcttatacc
# Same sequence, but with only the 20bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG
# Same sequence, but with only the 15bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH]
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01 [IGH] BUG-LOCUS
\ No newline at end of file
# attactgtgccacctgggATgttaggagaaactctt
# V8 attactgtgccacctgggAT |||||||||
# J1 ttattataagaaactctt
>TRGV8*01 3/GTTAGG/8 TRGJ1*02
Markdown is supported
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment