Commit 5429d503 authored by Thonier Florian's avatar Thonier Florian

algo/test/data; rename filename, add normalized reads fields

Link to #3944
parent ce69f30b
......@@ -3,7 +3,7 @@
"samples" : {
"number" : 1,
"original_names" : [ "/some/file" ] ,
"original_names" : [ "/some/file_1" ] ,
"run_timestamp" : [ "2015-02-19 16:37:06" ] ,
"producer" : [ "vidjil dev 0cf35de (2015-02-17)" ] ,
"log" : [ "Some log" ],
......
......@@ -3,7 +3,7 @@
"samples" : {
"number" : 1,
"original_names" : [ "/some/file" ] ,
"original_names" : [ "/some/file_2" ] ,
"run_timestamp" : [ "2015-02-19 16:37:06" ] ,
"producer" : [ "vidjil dev 0cf35de (2015-02-17)" ] ,
"log" : [ "Some log" ],
......@@ -27,6 +27,7 @@
"sequence" : "seq-1",
"reads" : [ 300 ] ,
"normalized_reads" : [ 500 ] ,
"top" : 1,
"germline" : "IGH"
},
......
{
"categories": [{
"cat": "a_category",
"disease": "healthy"
}],
"clones": [ {
"_average_read_length": [
76.0
],
"_coverage": [
0.973684191703796
],
"_coverage_info": [
"74 bp (97% of 76.0 bp)"
],
"germline": "IGK",
"id": "TACTGTCAACAGAGTTACAGTACCCCGTACACTTTTGGCCAGGGGACCAA",
"name": "IGKV1-39*01 3//1 IGKJ2*01",
"reads": [
5653
],
"seg": {
"3": {
"delLeft": 1,
"name": "IGKJ2*01",
"start": 37
},
"5": {
"delRight": 3,
"name": "IGKV1-39*01",
"stop": 36
},
"N": 0,
"affectSigns": {
"seq": "---------------------------- --------------------------",
"start": 1,
"stop": 74
},
"affectValues": {
"seq": "kkkkkkkkkkkkkkkkkkkkkkkkkkkk__________KKKKKKKKKKKKKKKKKKKKKKKKKK",
"start": 1,
"stop": 74
},
"cdr3": {
"aa": "QQSYSTPYT",
"start": 17,
"stop": 43
},
"evalue": {
"val": "1.180765e-43"
},
"evalue_left": {
"val": "1.296443e-47"
},
"evalue_right": {
"val": "1.180635e-43"
},
"junction": {
"aa": "CQQSYSTPYTF",
"productive": true,
"start": 14,
"stop": 46
},
"quality": {
"seq": "!!!!!!!!!!IGIHIIIIIIIIIIIIIIIIIIIIIIIJIIIIIIIJJJJJJJJJJJJIII!!!!!!!!!!!!!!",
"start": 1,
"stop": 74
}
},
"seg_stat": {
"3": 5653
},
"sequence": "TGCAACTTACTACTGTCAACAGAGTTACAGTACCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC",
"top": 1
},
{
"_average_read_length": [
76.0
],
"_coverage": [
1.0
],
"_coverage_info": [
"76 bp (100% of 76.0 bp)"
],
"germline": "IGK",
"id": "TACTGTCAGCAGTATGGTAGCTCACCGTACACTTTTGGCCAGGGGACCAA",
"name": "IGKV3-20*01 3//1 IGKJ2*01",
"reads": [
3898
],
"seg": {
"3": {
"delLeft": 1,
"name": "IGKJ2*01",
"start": 35
},
"5": {
"delRight": 3,
"name": "IGKV3-20*01",
"stop": 34
},
"N": 0,
"affectSigns": {
"seq": " ---------------------------- ------------------------",
"start": 1,
"stop": 76
},
"affectValues": {
"seq": "____kkkkkkkkkkkkkkkkkkkkkkkkkkkk__________KKKKKKKKKKKKKKKKKKKKKKKK",
"start": 1,
"stop": 76
},
"cdr3": {
"aa": "QQYGSSPYT",
"start": 15,
"stop": 41
},
"evalue": {
"val": "1.075621e-39"
},
"evalue_left": {
"val": "4.476181e-43"
},
"evalue_right": {
"val": "1.075173e-39"
},
"junction": {
"aa": "CQQYGSSPYTF",
"productive": true,
"start": 12,
"stop": 44
},
"quality": {
"seq": "!!!!!!!!IGIIIHGIHHIIIIIIIIJIIIIIIJIIJIJIIIIJJJIJJIJJIJJJII!!!!!!!!!!!!!!!!!!",
"start": 1,
"stop": 76
}
},
"seg_stat": {
"3": 3898
},
"sequence": "CAGTGTATTACTGTCAGCAGTATGGTAGCTCACCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGAAC",
"top": 2
},
{
"_average_read_length": [
76.0
],
"_coverage": [
1.0
],
"_coverage_info": [
"76 bp (100% of 76.0 bp)"
],
"germline": "IGK",
"id": "TACTGTCAACAGTATGATAATCTCCCGTACACTTTTGGCCAGGGGACCAA",
"name": "IGKV1-33*01 3//1 IGKJ2*01",
"reads": [
2597
],
"seg": {
"3": {
"delLeft": 1,
"name": "IGKJ2*01",
"start": 39
},
"5": {
"delRight": 3,
"name": "IGKV1-33*01",
"stop": 38
},
"N": 0,
"affectSigns": {
"seq": "---------------------------- ----------------------------",
"start": 1,
"stop": 76
},
"affectValues": {
"seq": "kkkkkkkkkkkkkkkkkkkkkkkkkkkk__________KKKKKKKKKKKKKKKKKKKKKKKKKKKK",
"start": 1,
"stop": 76
},
"cdr3": {
"aa": "QQYDNLPYT",
"start": 19,
"stop": 45
},
"evalue": {
"val": "2.592885e-47"
},
"evalue_left": {
"val": "1.296443e-47"
},
"evalue_right": {
"val": "1.296443e-47"
},
"junction": {
"aa": "CQQYDNLPYTF",
"productive": true,
"start": 16,
"stop": 48
},
"quality": {
"seq": "!!!!!!!!!!!!IIIIIIHHHIHIIJIIIIIIGHHIIIJJJJIJIIJIIJIJJJJJJJIJJJ!!!!!!!!!!!!!!",
"start": 1,
"stop": 76
}
},
"seg_stat": {
"3": 2597
},
"sequence": "ATTGCAACATATTACTGTCAACAGTATGATAATCTCCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC",
"top": 3
},
{
"_average_read_length": [
76.0
],
"_coverage": [
0.973684191703796
],
"_coverage_info": [
"74 bp (97% of 76.0 bp)"
],
"germline": "IGK",
"id": "TACTGTCAGCAATATTATAGTACTCCGTACACTTTTGGCCAGGGGACCAA",
"name": "IGKV4-1*01 3//1 IGKJ2*01",
"reads": [
2520
],
"seg": {
"3": {
"delLeft": 1,
"name": "IGKJ2*01",
"start": 35
},
"5": {
"delRight": 3,
"name": "IGKV4-1*01",
"stop": 34
},
"N": 0,
"affectSigns": {
"seq": " ---------------------------- ------------------------",
"start": 1,
"stop": 74
},
"affectValues": {
"seq": "__kkkkkkkkkkkkkkkkkkkkkkkkkkkk__________KKKKKKKKKKKKKKKKKKKKKKKK",
"start": 1,
"stop": 74
},
"cdr3": {
"aa": "QQYYSTPYT",
"start": 15,
"stop": 41
},
"evalue": {
"val": "1.075178e-39"
},
"evalue_left": {
"val": "5.525986e-45"
},
"evalue_right": {
"val": "1.075173e-39"
},
"junction": {
"aa": "CQQYYSTPYTF",
"productive": true,
"start": 12,
"stop": 44
},
"quality": {
"seq": "!!!!!!!!IHIIIIHIIIJIIIIIIIIIHGIGIJJJIJJJIIJJJJIIJJIJIJJJII!!!!!!!!!!!!!!!!",
"start": 1,
"stop": 74
}
},
"seg_stat": {
"3": 2520
},
"sequence": "CAGTTTATTACTGTCAGCAATATTATAGTACTCCGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACGA",
"top": 4
},
{
"_average_read_length": [
76.0
],
"_coverage": [
1.0
],
"_coverage_info": [
"76 bp (100% of 76.0 bp)"
],
"germline": "IGK",
"id": "TGTCAGCAGTATAATAACTGGCCTCCGCTCACTTTCGGCGGAGGGACCAA",
"name": "IGKV3-15*01 0//0 IGKJ4*01",
"reads": [
2502
],
"seg": {
"3": {
"delLeft": 0,
"name": "IGKJ4*01",
"start": 46
},
"5": {
"delRight": 0,
"name": "IGKV3-15*01",
"stop": 45
},
"N": 0,
"affectSigns": {
"seq": "--------------------- -----------------------------------",
"start": 1,
"stop": 76
},
"affectValues": {
"seq": "kkkkkkkkkkkkkkkkkkkkk__________KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK",
"start": 1,
"stop": 76
},
"cdr3": {
"aa": "QQYNNWPPLT",
"start": 23,
"stop": 52
},
"evalue": {
"val": "9.343769e-34"
},
"evalue_left": {
"val": "9.343769e-34"
},
"evalue_right": {
"val": "1.798806e-61"
},
"junction": {
"aa": "CQQYNNWPPLTF",
"productive": true,
"start": 20,
"stop": 55
},
"quality": {
"seq": "!!!!!!!!!!!!!!!!!!!HIHIIIIIIIJJIIHIIIIIIIIIIIJIIIIIIIIIJIIJJIIIIIIHIH!!!!!!!",
"start": 1,
"stop": 76
}
},
"seg_stat": {
"3": 2502
},
"sequence": "AGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCGCTCACTTTCGGCGGAGGGACCAAGGTGGAG",
"top": 5
}
],
"diversity": {
"index_Ds_diversity": 0.999757289886475,
"index_E_equitability": 0.710613250732422,
"index_H_entropy": 9.92569569544503
},
"germlines": {
"custom": {
"3": [],
"4": [],
"5": [],
"shortcut": "X"
},
"ref": "http://www.vidjil.org/germlines/germline-49.tar.gz",
"species": "Homo sapiens",
"species_taxon_id": 9606
},
"reads": {
"germline": {
"IGH": [
190947
],
"IGH+": [
78925
],
"IGK": [
657338
],
"IGK+": [
0
],
"IGL": [
235104
],
"TRA": [
0
],
"TRA+D": [
0
],
"TRB": [
2
],
"TRB+": [
0
],
"TRD": [
0
],
"TRD+": [
0
],
"TRG": [
0
],
"unexpected": [
2168
]
},
"segmented": [
1164484
],
"total": [
105515154
]
},
"samples": {
"commandline": [
"vidjil-algo -o result/ -c clones -3 -z 100 -r 1 -ggermline/homo-sapiens.g -e 1 -2 -d -w 50 /mnt/data/sequence_file.fastq.gz "
],
"log": [
" ==> junction detected in 1164484 reads (1.1%)\n ==> found 94208 windows in 1164484 reads (1.1% of 105515154 reads)\n ! There are not so many CDR3 windows found in this set of reads.\n ! Please check the unsegmentation causes below and refer to the documentation.\n reads av. len clones clo/rds\n IGH -> 190947 76.0 20065 0.105\n IGH+ -> 78925 76.0 10363 0.131\n IGK -> 657338 76.0 43921 0.067\n IGK+ -> 0 - 0 -\n IGL -> 235104 76.0 19478 0.083\n TRA -> 0 - 0 -\n TRA+D -> 0 - 0 -\n TRB -> 2 76.0 1 0.500\n TRB+ -> 0 - 0 -\n TRD -> 0 - 0 -\n TRD+ -> 0 - 0 -\n TRG -> 0 - 0 -\n unexpected -> 2168 76.0 380 0.175\n\n SEG -> 1164484 76.0\n SEG_+ -> 2858 76.0\n SEG_- -> 1161626 76.0\n SEG changed w -> 412847 76.0\n\n UNSEG too short -> 0 -\n UNSEG strand -> 395256 76.0\n UNSEG too few V/J -> 91046588 76.0\n UNSEG only V/5' -> 11147607 76.0\n UNSEG only J/3' -> 1760542 76.0\n UNSEG < delta_min -> 0 -\n UNSEG ambiguous -> 677 76.0\n UNSEG too short w -> 0 -\n"
],
"number": 1,
"original_names": [
"sequence_file"
],
"producer": [
"vidjil-algo 2018.02"
],
"run_timestamp": [
"2019-01-01 01:01:01"
]
},
"similarity": [
],
"vidjil_json_version": "2016b",
"warn": [
{
"code": "W20",
"msg": "Very few V(D)J recombinations found: 1.10%"
}
]
}
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment