Commit 5370c5c2 authored by Marc Duez's avatar Marc Duez
Browse files
parents 6ed4e140 02678ab3
......@@ -208,7 +208,8 @@ void IKmerStore<T>::insert(const seqtype &sequence,
const string &label,
bool ignore_extended_nucleotides){
for(size_t i = 0 ; i + s < sequence.length() + 1 ; i++) {
seqtype kmer = spaced(sequence.substr(i, s), seed);
seqtype substr = sequence.substr(i, s);
seqtype kmer = spaced(substr, seed);
if (ignore_extended_nucleotides && has_extended_nucleotides(kmer))
continue;
......@@ -227,7 +228,7 @@ void IKmerStore<T>::insert(const seqtype &sequence,
}
this_kmer += T(label, strand);
if (revcomp_indexed && ! T::hasRevcompSymetry()) {
seqtype rc_kmer = revcomp(kmer);
seqtype rc_kmer = spaced(revcomp(substr), seed);
T &this_rc_kmer = this->get(rc_kmer);
if (this_rc_kmer.isNull())
nb_kmers_inserted++;
......
# Sequences split among two germlines (depending on the strand).
# Either VdJa (correct)
# or TRD (TRV1-TRDD2-TRDJ2)
>TRDV1*01_5//3_TRDD2*01_1//7_TRAJ29*01__VdJa
AGCGGGTGGTGATGGCAAATGCCAAGGAAGGGAAAAGGAAGAAGAGGGTTTTTATACTGATGTGTTTCATTGTGGGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGTCCCAATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGTCCTAAGGAAACACACCTCTTGTCTTTGGAAAGGGCACAAGACTTTCTGTGATTGCAAGTAAGTGTTTCTAGCCATCCTTGATTTTGATCAGCAATGGCTTCTTCCCTTGAATTATTTTTCAGTGTACCTAGAATGCTTTTGCC
!LAUNCH: ../../vidjil -i -g ../../germline/ -r 1 -c clones ../../data/revcomp-VdJa.fa
$ Just one window found
f1:==> found 1 ..-windows
1:==> found 1 ..-windows
$ Just one clone found
f1:==> 1 clones
1:==> 1 clones
$ Two reads segmented in VdJa
1:VdJa -> 2
$ segmentation for the main clone
f1:TRDV1.01 5//3 TRDD2.01 1//7 TRAJ29
1:TRDV1.01 5//3 TRDD2.01 1//7 TRAJ29
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment