Commit 51cf9db6 authored by Mikaël Salson's avatar Mikaël Salson

should-vdj-tests: PAP sequence assignation bug

Differs on + and - strand. Incorrect on both
parent 221b52c1
>IGHD3-9*01 16/CT/23 IGHJ6*02 [IGH+] TODO
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGTTTGGAGTGAGGTCTGTGTCACTGTGGTATTACGATATTTT
CT
GACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTAAG
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment