Commit 5186499f authored by marc duez's avatar marc duez Committed by Mathieu Giraud
Browse files

fix functional tests

parent 9940a636
......@@ -50,7 +50,7 @@ QUnit.test("read details", function(assert) {
m.keep_one_active_system('IGH')
info.update();
var sbnm = document.getElementsByClassName('systemBoxNameMenu')
assert.includes(sbnm[0].outerHTML, '<span class="systemBoxNameMenu inactive TRG">', 'system box TRG is inactive')
assert.includes(sbnm[0].outerHTML, '<span class="systemBoxNameMenu unchecked TRG">', 'system box TRG is inactive')
assert.includes(sbnm[1].outerHTML, '<span class="systemBoxNameMenu IGH">', 'system box IGH is still active')
var reads = document.getElementsByClassName('reads_details')[0]
......
......@@ -187,13 +187,15 @@ end
$b.clone_in_scatterplot('3').click
sleep 1
# If cdr3 checked, the sequence will be split in mutiple dom element with highlight or not
check = $b.checkbox(:id => "vdj_input_check")
$b.div(:id => 'align-segment-info').hover
check = $b.checkbox(:id => "aligner_checkbox_CDR3")
if check.set? # by default, in chromium based browser, the checkbox is set to true
check.click
end
assert ( not check.set? ), "CDR3 checkbox is not checked"
assert ( $b.clone_in_segmenter('3').exists? ), ">> clone 3 is correctly present in the segmenter, without infinite loop"
assert ( $b.span(:id => 'sequence-clone-3').text.include? 'GGGGGCCCCCGGGGGCCCCCGGGGGCCCCCGGGGGCCCCCAAAAATTTTTAAAAATTTTTAAAAATTTTT'), "sequence of analysis loaded replace sequence of vidjil file"
assert ( $b.li(:id => 'seq3').text.include? 'GGGGGCCCCCGGGGGCCCCCGGGGGCCCCCGGGGGCCCCCAAAAATTTTTAAAAATTTTTAAAAATTTTT'), "sequence of analysis loaded replace sequence of vidjil file"
end
def test_zz_close
......
......@@ -235,7 +235,7 @@ class VidjilBrowser < Watir::Browser
end
def merge
return element(:id => 'merge')
return element(:id => 'cluster')
end
def select_tag(id, extra={})
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment