Nous avons procédé ce jeudi matin 08 avril 2021 à une MAJ de sécurité urgente. Nous sommes passé de la version 13.9.3 à la version 13.9.5 les releases notes correspondantes sont ici:
https://about.gitlab.com/releases/2021/03/17/security-release-gitlab-13-9-4-released/
https://about.gitlab.com/releases/2021/03/31/security-release-gitlab-13-10-1-released/

Commit 50fc5e97 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: add tests, dumping and reading labels with --label

Opens #3839.
parent fd0f80df
{
"config": {
"labels": [
{ "name": "lab1", "sequence": "CGAGAGTGGGCAGCAGCTGG", "foo": 42 },
{ "name": "lab2", "sequence": "GAAGGGCTACTATGGTTCGGG", "bar": 17}
]
}
}
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH --max-consensus 0 --first-reads 10 --label-json ../data/labels-json.vidjil $VIDJIL_DATA/Stanford_S22.fasta
$ Labels are taken into account
: 2 labels
: Considering labeled windows
$ Report two clones, even with --max-consensus 0
: ==> 2 clones
!LAUNCH: cat out/Stanford_S22.vidjil
$ Labels are in the .json output
1: "label": "lab1"
1: "label": "lab2"
$ Other values from label-json.vidjil are also in the .json output
1: "foo": 42
1: "bar": 17
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment