Commit 4b91759b authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud

0000-nck-TRA+D.should-vdj.fa: Fourth sequence checked.

It passes with Vidjil now. IMGT agrees.
parent c91ad79a
......@@ -11,8 +11,7 @@ AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAA
##############################################
# Erreur de nomage a arbitrer (sanger ET vidjil faux ? )
>TRBV10-2*01 4/7/4 TRBJ1-2*01 [TRB] TODO
>TRBV10-2*01 4/CC/3 TRBD2*01 7//5,8//4 TRBJ1-2*01 [TRB]
GCTGATATTACAGATAAAGGAgAAGTCCCCGATGGCTATGTTGTCTCCAGATCCAAGACAGAGAATtTCCCCCTCACTCTGGAGTCaGCtACCCGCTCCCAgACATCTGTGTATTTCTGCGCCaGCAGTGCCACTAgCTaTGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGGTAAG
# verifier seq
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment