Merge branch 'feature-ct/mrd_brasil_tool_and_client' into 'dev'

Feature ct/mrd brasil tool and client

See merge request !781

browser/js/app.js

@@ -91,6 +91,7 @@ function loadAfterConf() {
                                          "../vidjil_vmi",
                                          "../../test/QUnit/testFiles/data_test",
                                         ], function(){
+                                            
                                             if (typeof main == "undefined"){
                                                 require(["../main"]);
                                             }else{
@@ -99,6 +100,8 @@ function loadAfterConf() {
                                             if (typeof config.addons !== "undefined") {
                                                 require(config.addons);
                                             }
+                                            require(["../screen_MRD"]);
+                                            
                                         })
                             })
                 },

browser/js/clone.js

@@ -1333,8 +1333,26 @@ Clone.prototype = {
         var time_length = this.m.samples.order.length
         var html = ""
 
-        var header = function(content) { return "<tr><td class='header' colspan='" + (time_length + 1) + "'>" + content + "</td></tr>" ; }
-        var row_1  = function(item, content) { return "<tr><td>" + item + "</td><td colspan='" + time_length + "'>" + content + "</td></tr>" ; }
+        // Functions to format html row
+        var clean_title = function(title){ return title.replace(/[&\/\\#,+()$~%.'":*?<>{} ]/gi,'_').replace(/__/gi,'_')}
+        var header = function(content, title) { 
+            title = (title == undefined) ? clean_title(content) : clean_title(title)
+            return "<tr id='modal_header_"+title+"'><td class='header' colspan='" + (time_length + 1) + "'>" + content + "</td></tr>" ; 
+        }
+        var row_1  = function(item, content, title) { 
+            title = (title == undefined) ? clean_title(item) : clean_title(title)
+            return "<tr id='modal_line_"+title+"'><td id='modal_line_title_"+title+"'>" + item + "</td><td colspan='" + time_length + "' id='modal_line_value_"+title+"'>" + content + "</td></tr>" ; 
+        }
+        var row_from_list  = function(item, content, title) { 
+            title = (title == undefined) ?clean_title(item) : clean_title(title)
+            var div = "<tr id='modal_line_"+title+"'><td id='modal_line_title_"+title+"'>"+ item + "</td>"
+            for (var i = 0; i < content.length; i++) {
+                col  = content[i]
+                div += "<td id='modal_line_value_"+title+"_"+i+"'>" + col + "</td>"
+            }
+            div += "</tr>" ;
+            return div;
+        }
 
         if (isCluster) {
             html = "<h2>Cluster info : " + this.getName() + "</h2>"
@@ -1356,9 +1374,22 @@ Clone.prototype = {
         //warnings
         if (this.isWarned()) {
             html += header("warnings")
-
+            var warnings = {}
+            // Create a dict of all warning present, and add each sample with it
+            // One warning msg by entrie, without duplication.
             for (i = 0; i < this.warn.length; i++) {
-                html += row_1(this.warn[i].code, this.warn[i].msg);
+                if (this.warn[i] != 0 && this.warn[i] != undefined){
+                    if (warnings[this.warn[i].msg] == undefined){
+                        warnings[this.warn[i].msg] = {"code":this.warn[i].code, "msg": this.warn[i].msg, "samples":[i]}
+                    } else {
+                        warnings[this.warn[i].msg].samples.push(i)
+                    }
+                }
+            }
+            // put warning html content, with list of concerned sample, without duplication
+            for (var warn in warnings) {
+                var pluriel = warnings[warn].samples.length > 1 ? "s" : ""
+                html += row_1(warnings[warn].code, warnings[warn].msg);
             }
         }
 
@@ -1394,6 +1425,15 @@ Clone.prototype = {
             for (var k = 0; k < time_length; k++) {
                 html += "<td>" + this.getStrSize(this.m.samples.order[k]) + "</td>"
             }
+
+            // Specific part for MRD script
+            if ('mrd' in this && this.getHtmlInfo_prevalent != undefined){
+                values = this.getHtmlInfo_prevalent()
+                for (var mrd_val = 0; mrd_val < values.length; mrd_val++) {
+                    html += row_from_list(values[mrd_val][0], values[mrd_val][1], values[mrd_val][2])
+                }
+            }
+
             html += header("representative sequence")
         }else{
             html += header("sequence")
@@ -1451,7 +1491,7 @@ Clone.prototype = {
         if (this.hasSizeConstant()) {
             html += header("segmentation" +
                 " <button type='button' onclick='m.clones["+ this.index +"].toggle()'>edit</button>" + //Use to hide/display lists 
-                this.getHTMLModifState()) // icon if manual changement
+                this.getHTMLModifState(), "segmentation") // icon if manual changement
         } else {
             html += header("segmentation")
         }
@@ -1970,6 +2010,8 @@ Clone.prototype = {
             return x.equals(axes)
         }
     },
+
+
 };
 
 

browser/js/screen_MRD.js

+/*
+ * This file is part of Vidjil <http://www.vidjil.org>,
+ * High-throughput Analysis of V(D)J Immune Repertoire.
+ * Copyright (C) 2013-2020 by Bonsai bioinformatics
+ * at CRIStAL (UMR CNRS 9189, Université Lille) and Inria Lille
+ * Contributors: 
+ *     Joao Meidanis <joao.m@boldrini.org.br>
+ *     The Vidjil Team <contact@vidjil.org>
+ *
+ * "Vidjil" is free software: you can redistribute it and/or modify
+ * it under the terms of the GNU General Public License as published by
+ * the Free Software Foundation, either version 3 of the License, or
+ * (at your option) any later version.
+ *
+ * "Vidjil" is distributed in the hope that it will be useful,
+ * but WITHOUT ANY WARRANTY; without even the implied warranty of
+ * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the
+ * GNU General Public License for more details.
+ *
+ * You should have received a copy of the GNU General Public License
+ * along with "Vidjil". If not, see <http://www.gnu.org/licenses/>
+ */
+
+
+/**
+ * Adding functionality to the Clone object so that it can display MRD
+ * estimates obtained from the .vidjil file as modified by
+ * spike-normalization.py in the info box.
+ * 
+ * The Clone methods added here are new
+ * The exception of getHtmlInfo-prevalent is call if needed from 
+ * getHTMLInfo function of Clone prototype.
+ * Coding conventions and comment styles are borrowed from clone.js.
+ */
+UNIVERSAL_FAMILY = "UNI"
+UNIVERSAL_COEFF  = 'UNI_COEFF'
+UNIVERSAL_R2     = 'UNI_R2'
+
+
+function ScreenMRD() {}
+
+ScreenMRD.prototype = {
+
+    /**
+     * @return {string} the family used for fiting at the given time
+     */
+    getFittingFamily : function(time) {
+        if (this.m.mrd.prevalent[time] == 0) {
+            // diagnostic sample
+            return "";
+        } else if (this.mrd != undefined && 'family' in this.mrd) {
+        return this.mrd.family[time];
+        } else {
+            // negative clone: report UNI
+            return UNIVERSAL_FAMILY;
+        }
+    },
+
+
+    /**
+     * @return {string} the normalization coefficient at the given time
+     */
+    getNormCoeff : function(time) {
+        if (this.m.mrd.prevalent[time] == 0) {
+            // diagnostic sample
+            return "";
+        } else if (this.mrd != undefined && 'norm_coeff' in this.mrd) {
+            return this.mrd.norm_coeff[time];
+        } else if (UNIVERSAL_COEFF in this.m.mrd) {
+            // negative clone:report UNI
+            return this.m.mrd.UNI_COEFF[time];
+        } else {
+            return "";
+        }
+    },
+
+    /**
+     * @return {string} the Pearson R2 value for the spike-in fitting at the given time
+     */
+    getR2 : function(time) {
+        if (this.m.mrd.prevalent[time] == 0) {
+            // diagnostic sample
+            return "";
+        } else if (this.mrd != undefined && 'R2' in this.mrd) {
+        return this.mrd.R2[time]//.toString();
+        } else if (UNIVERSAL_R2 in this.m.mrd) {
+            // negative clone: report UNI R2
+            return this.m.mrd.UNI_R2[time];
+        } else {
+        return "";
+        }
+    },
+        
+        
+    /**
+     * @return {string} the prevalent germline at the given time
+     */
+    getPrevalent : function(time) {
+        if (this.m.mrd.prevalent[time] == 0) {
+            // diagnostic sample
+            return "";
+        } else {
+        return this.m.mrd.prevalent[time];
+        }
+    },
+
+
+    /**
+     * @return {string} the amplification coefficient at the given time
+     * (ampl. coeff. = total prevalent / total spike)
+     */
+    getAmplCoeff : function(time) {
+        if (this.m.mrd.prevalent[time] == 0) {
+            // diagnostic sample
+            return "";
+        } else if ('ampl_coeff' in this.m.mrd) {
+        return this.m.mrd.ampl_coeff[time]//.toString();
+        } else {
+        return "Please use version 6 or later of spike-normalization";
+        }
+    },
+
+
+    /**
+     * Return info about a sequence/clone in html
+     */
+    getHtmlInfo_prevalent : function () {
+        values = []
+
+        if ('mrd' in this) {
+            // this .vidjil file is not all-diagnostic:
+            // show R2, etc, fields for follow-up samples
+            content_fitting_family = []
+            content_norm_coeff     = []
+            content_getR2 = []
+            content_getPrevalent = []
+            content_getAmplCoeff = []
+            for (k = 0; k < this.m.samples.order.length; k++) {
+                var sample    = this.m.samples.order[k]
+
+                // Get prevalent value
+                var prevalent = this.getPrevalent(sample)
+                if (prevalent != ""){
+                    prevalent = this.m.systemBox(prevalent).outerHTML + prevalent
+                }
+                content_getPrevalent.push(   prevalent )
+
+                // Computed values
+                content_fitting_family.push( this.getFittingFamily(sample) )
+                content_norm_coeff.push(     this.getNormCoeff(sample))
+                content_getR2.push(          this.getR2(sample) )
+                content_getAmplCoeff.push(   this.getAmplCoeff(sample) )
+            }
+            // include values into html
+            // name of col, values to show, and DOM id for cells
+            values.push(["prevalent germline",             content_getPrevalent,   "mrd_prevalent"])
+            values.push(["family used for fitting",        content_fitting_family, "mrd_family"])
+            values.push(["normalization coefficient",      content_norm_coeff,     "mrd_norm_coeff"])
+            values.push(["Pearson R2",                     content_getR2,          "mrd_pearson"])
+            values.push(["total prevalent / total spikes", content_getAmplCoeff,   "mrd_prevalent_on_spike"])
+        }
+
+        return values
+    }
+
+}
+
+Clone.prototype = $.extend(Object.create(ScreenMRD.prototype), Clone.prototype);
\ No newline at end of file

browser/test/QUnit/testFiles/clone_test.js

@@ -228,21 +228,33 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
     assert.includes(html, "<div id='info_window'><table><tr><th></th><td>Diag</td><td>Fu-1</td><td>Fu-2</td><td>Fu-3</td></tr>",
              "getHtmlInfo: cluster info");
 
-    assert.includes(html, "<tr><td>clone name</td><td colspan='4'>hello</td></tr><tr><td>clone short name</td><td colspan='4'>hello</td></tr>",
+    assert.includes(html, "tr id='modal_line_clone_name'><td id='modal_line_title_clone_name'>clone name</td><td colspan='4' id='modal_line_value_clone_name'>hello</td></tr>",
              "getHtmlInfo: clone names")
 
     assert.includes(html, "<tr><td>clone size (n-reads (total reads))</td><td>20  (200)</td><td>20  (100)</td><td>30  (200)</td><td>30  (100)</td></tr><tr><td>clone size (%)</td><td>10.00%</td><td>20.00%</td><td>15.00%</td><td>30.00%</td>",
              "getHtmlInfo: clone information");
     
-    assert.includes(html, "<tr><td class='header' colspan='5'>representative sequence</td></tr><tr><td>sequence name</td><td colspan='4'>hello</td></tr><tr><td>code</td><td colspan='4'>hello</td></tr><tr><td>length</td><td colspan='4'>19</td></tr><tr><td>e-value</td><td colspan='4'><span class='warning'>0.01</span></td></tr><tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
-        "getHtmlInfo: representative sequence information");
-
-    assert.includes(html, "<tr><td class='header' colspan='5'>segmentation <button type='button' onclick='m.clones[0].toggle()'>edit</button></td></tr><tr><td>sequence</td><td colspan='4'>aaaaaaaaaattttttttt</td></tr><tr><td>id</td><td colspan='4'>id1</td></tr>",
-        "getHtmlInfo: segmentation information + modification button");
+    assert.includes(html, "<tr id='modal_line_sequence_name'><td id='modal_line_title_sequence_name'>sequence name</td><td colspan='4' id='modal_line_value_sequence_name'>hello</td></tr><tr id='modal_line_code'><td id='modal_line_title_code'>code</td><td colspan='4' id='modal_line_value_code'>hello</td></tr><tr id='modal_line_length'><td id='modal_line_title_length'>length</td><td colspan='4' id='modal_line_value_length'>19</td></tr><tr id='modal_line_e-value'><td id='modal_line_title_e-value'>e-value</td><td colspan='4' id='modal_line_value_e-value'><span class='warning'>0.01</span></td></tr><tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; sequence name");
+    assert.includes(html, "<tr id='modal_line_code'><td id='modal_line_title_code'>code</td><td colspan='4' id='modal_line_value_code'>hello</td></tr><tr id='modal_line_length'><td id='modal_line_title_length'>length</td><td colspan='4' id='modal_line_value_length'>19</td></tr><tr id='modal_line_e-value'><td id='modal_line_title_e-value'>e-value</td><td colspan='4' id='modal_line_value_e-value'><span class='warning'>0.01</span></td></tr><tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; code");
+    assert.includes(html, "<tr id='modal_line_length'><td id='modal_line_title_length'>length</td><td colspan='4' id='modal_line_value_length'>19</td></tr><tr id='modal_line_e-value'><td id='modal_line_title_e-value'>e-value</td><td colspan='4' id='modal_line_value_e-value'><span class='warning'>0.01</span></td></tr><tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; length");
+    assert.includes(html, "<tr id='modal_line_e-value'><td id='modal_line_title_e-value'>e-value</td><td colspan='4' id='modal_line_value_e-value'><span class='warning'>0.01</span></td></tr><tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; evalue");
+    assert.includes(html, "<tr><td>size (n-reads (total reads))</td><td>10  (200)</td><td>10  (100)</td><td>0  (200)</td><td>30  (100)</td></tr><tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; size total");
+    assert.includes(html, "<tr><td>size (%)</td><td>5.000%</td><td>10.00%</td><td>−</td><td>30.00%</td></tr>",
+        "getHtmlInfo: representative sequence information; size %");
+
+    assert.includes(html, "<tr id='modal_header_segmentation'><td class='header' colspan='5'>segmentation <button type='button' onclick='m.clones[0].toggle()'>edit</button></td></tr>",
+        "getHtmlInfo: segmentation information + modification button; header");
+    assert.includes(html, "<tr id='modal_line_sequence'><td id='modal_line_title_sequence'>sequence</td><td colspan='4' id='modal_line_value_sequence'>aaaaaaaaaattttttttt</td></tr>",
+        "getHtmlInfo: segmentation information + modification button; content");
     // Test icon 
     m.clones[0].segEdited = true;
     html = m.clones[0].getHtmlInfo();
-    assert.includes(html, "<tr><td class='header' colspan='5'>segmentation <button type='button' onclick='m.clones[0].toggle()'>edit</button> <img src='images/icon_fav_on.png' alt='This clone has been edited by a user'></td></tr><tr><td>sequence</td><td colspan='4'>aaaaaaaaaattttttttt</td></tr><tr><td>id</td><td colspan='4'>id1</td></tr>",
+    assert.includes(html, "<tr id='modal_header_segmentation'><td class='header' colspan='5'>segmentation <button type='button' onclick='m.clones[0].toggle()'>edit</button> <img src='images/icon_fav_on.png' alt='This clone has been edited by a user'></td></tr>",
         "getHtmlInfo: segmentation information + modification button + manuallyChanged icon");
     
     // <tr><td>locus</td><td colspan='4'><span title=\"TRG\" class=\"systemBoxMenu\">G</span>TRG</td></tr> // not tested (order of title/class)
@@ -253,11 +265,11 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
     /*assert.includes(html, "<tr><td>locus</td><td colspan='4'><span title=\"TRG\" class=\"systemBoxMenu\">G</span>TRG<div class='div-menu-selector' id='listLocus' style='display: none'>",
         "getHtmlInfo: segmentation information (Locus)");*/
 
-    assert.includes(html, "<tr><td>V gene (or 5')</td><td colspan='4'>undefined V<div class='div-menu-selector' id='listVsegment' style='display: none'>",
+    assert.includes(html, "<tr id='modal_line_V_gene_or_5_'><td id='modal_line_title_V_gene_or_5_'>V gene (or 5')</td><td colspan='4' id='modal_line_value_V_gene_or_5_'>undefined V<div class='div-menu-selector' id='listVsegment' style='display: none'><form name=Vsegment>",
         "getHtmlInfo: segmentation information (V gene)");
-    assert.includes(html, "<tr><td>(D gene)</td><td colspan='4'>IGHD2*03<div class='div-menu-selector' id='listDsegment' style='display: none'>",
+    assert.includes(html, "<tr id='modal_line__D_gene_'><td id='modal_line_title__D_gene_'>(D gene)</td><td colspan='4' id='modal_line_value__D_gene_'>IGHD2*03<div class='div-menu-selector' id='listDsegment' style='display: none'><form name=Dsegment><select class='menu-selector' NAME=Dsegment onChange='m.clones[0].changeSegment(this.form.Dsegment.value, 4);'  style='width: 100px' >",
         "getHtmlInfo: segmentation information (D gene)");
-    assert.includes(html, "<tr><td>J gene (or 3')</td><td colspan='4'>IGHV4*01<div class='div-menu-selector' id='listJsegment' style='display: none'>",
+    assert.includes(html, "<tr id='modal_line_J_gene_or_3_'><td id='modal_line_title_J_gene_or_3_'>J gene (or 3')</td><td colspan='4' id='modal_line_value_J_gene_or_3_'>IGHV4*01<div class='div-menu-selector' id='listJsegment' style='display: none'><form name=Jsegment>",
         "getHtmlInfo: segmentation information (J gene)");
 
     // forms tests
@@ -280,16 +292,16 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
         "<option value=IGH>IGH</option><option value=TRA>TRA</option>",
         "getHtmlInfo:  first options in select locus (after changment)"); // after germline changment
     assert.includes(html, 
-        "<tr><td>V gene (or 5')</td><td colspan='4'>testV5<div class='div-menu-selector' id='listVsegment' style='display: none'>",
+        "<tr id='modal_line_V_gene_or_5_'><td id='modal_line_title_V_gene_or_5_'>V gene (or 5')</td><td colspan='4' id='modal_line_value_V_gene_or_5_'>testV5<div class='div-menu-selector' id='listVsegment' style='display: none'><form name=Vsegment>",
         "getHtmlInfo: segmentation information (V gene) after changment");
 
     // Test junction in html export
-    assert.includes(html, "<tr><td>junction</td><td colspan='4'>att</td></tr>",
+    assert.includes(html, "<tr id='modal_line_junction'><td id='modal_line_title_junction'>junction</td><td colspan='4' id='modal_line_value_junction'>att</td></tr>",
                  "getHtmlInfo c1: junction info for productive clone");   
     html = c3.getHtmlInfo();
-    assert.includes(html, "<tr><td>junction</td><td colspan='4'>aaaaaaaatttt</td></tr>",
+    assert.includes(html, "<tr id='modal_line_junction'><td id='modal_line_title_junction'>junction</td><td colspan='4' id='modal_line_value_junction'>aaaaaaaatttt</td></tr>",
                  "getHtmlInfo c3: junction info for non productive clone");   
-    assert.includes(html, "<tr><td>junction (AA seq)</td><td colspan='4'>WKIC</td></tr>",
+    assert.includes(html, "<tr id='modal_line_junction_AA_seq_'><td id='modal_line_title_junction_AA_seq_'>junction (AA seq)</td><td colspan='4' id='modal_line_value_junction_AA_seq_'>WKIC</td></tr>",
                  "getHtmlInfo c3: junction (AAseq) info for non productive clone"); 
     // test sequence if not prsent
     html = c5.getHtmlInfo();
@@ -339,7 +351,7 @@ QUnit.test("name, informations, getHtmlInfo", function(assert) {
     include = html.includes("current clone size")
     assert.ok(include, "getHtmlInfo: if no sequence, field 'current clone size'");
     // gene V
-    assert.includes(html, "<tr><td>V gene (or 5')</td>",
+    assert.includes(html, "<tr id='modal_line_V_gene_or_5_'><td id='modal_line_title_V_gene_or_5_'>V gene (or 5')</td>",
         "getHtmlInfo: distrib clone with seg5 have field segment V");
     
     // Sequence

browser/test/data/issues/issue_mrd.vidjil

+{
+  "clones": [
+    {
+      "germline": "IGK",
+      "id": "AACAGTATAATAGTTCGCTCAGGGGGCGAGGGAATGAATTCACTTTCGGC",
+      "normalized_reads": [
+        195.50763372699805
+      ],
+      "reads": [
+        269
+      ],
+      "seg_stat": {
+        "3": 269
+      },
+      "sequence": 0,
+      "top": 231,
+      "mrd": {
+        "R2": [
+          0.95
+        ],
+        "copy_number": [41.37324910738808],
+        "family": [
+          "UNI"
+        ]
+      }
+    },
+    {
+      "_average_read_length": [
+        150.88140869140625
+      ],
+      "_coverage": [
+        0.987530529499054
+      ],
+      "_coverage_info": [
+        "149 bp (98% of 150.9 bp)"
+      ],
+      "germline": "IGK",
+      "id": "CTGTCAACAGAGTTACAGTACCCCTCGGACGTTCGGCCAAGGGACCAAGG",
+      "name": "IGKV1D-39*01 1//2 IGKJ1*01",
+      "normalized_reads": [
+        766.0410630046689
+      ],
+      "reads": [
+        1054
+      ],
+      "seg": {},
+      "seg_stat": {
+        "3": 1054
+      },
+      "sequence": "CAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCGGACGTTCGGCCAAGGGACCAAGGTGGAGATCAAACGTAAG",
+      "top": 10,
+      "mrd": {
+        "R2": [
+          0.96
+        ],
+        "copy_number": [162.10931062894807],
+        "family": [
+          "UNI"
+        ]
+      }
+    },
+    {
+      "_average_read_length": [
+        150.7296142578125
+      ],
+      "_coverage": [
+        0.9951594471931458
+      ],
+      "_coverage_info": [
+        "150 bp (99% of 150.7 bp)"
+      ],
+      "germline": "IGH",
+      "id": "GCCTCGGACACCGCCATGCCAAAACGGGGATAGCTACTGGTACTTCGATC",
+      "label": "Boldrini-VH5-C",
+      "name": "Boldrini-VH5-C IGHV5-51*05 0/CCAAAACGGGGATAG/0 IGHJ2*01",
+      "reads": [
+        7282
+      ],
+      "seg": {},
+      "seg_stat": {
+        "3": 7282
+      },
+      "sequence": "TCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGCCAAAACGGGGATAGCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCGGGTCACCGTCTCCTCAGGTAAG",
+      "top": 1
+    },
+    {
+      "germline": "unexpected",
+      "id": "GCGAAACAAGGGCCCCGAGTGGGGGAGGATGCTTTTGATATGTGGGACCA",
+      "reads": [
+        1
+      ],
+      "seg_stat": {
+        "3": 1
+      },
+      "sequence": 0,
+      "top": 38430
+    },
+    {
+      "germline": "IGH",
+      "id": "TTTTTTTTTTTTCAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCG",
+      "reads": [
+        1
+      ],
+      "seg_stat": {
+        "3": 1
+      },
+      "sequence": 0,
+      "top": 15
+    }
+  ],
+  "config": {
+    "all": false,
+    "alternative-genes": "0",
+    "analysis-e-value-D": "0.05",
+    "analysis-filter": "1",
+    "cdr3": true,
+    "clean-memory": false,
+    "cluster-N": "10",
+    "cluster-epsilon": "0",
+    "cluster-load-matrix": false,
+    "cluster-save-matrix": false,
+    "consensus-on-longest-sequences": false,
+    "dir": "./out/",
+    "e-value": "1",
+    "germline": "germline/homo-sapiens.g",
+    "help-advanced": false,
+    "label-filter": false,
+    "label-json": "docker/vidjil-server/conf/boldrini/Boldrini-spikes.json",
+    "labels": [
+      {
+        "copies": "10",
+        "family": "VH1",
+        "name": "Boldrini-VH1-A",
+        "reads": 0,
+        "sequence": "TTTTGAAGGATGGTAG",
+        "vfam": "VH1"
+      },
+      {
+        "copies": "40",
+        "family": "VH1",
+        "name": "Boldrini-VH1-B",
+        "reads": 0,
+        "sequence": "TGCGAGACATTCTTTTGACTACT",
+        "vfam": "VH1"
+      },
+      {
+        "copies": "160",
+        "family": "VH1",
+        "name": "Boldrini-VH1-C",
+        "reads": 0,
+        "sequence": "AGATCGGGGGGGAGGGTTCGGGGAGTTTTCCCCCGCCCATT",
+        "vfam": "VH1"
+      },
+      {
+        "copies": "10",
+        "family": "VH2",
+        "name": "Boldrini-VH2-A",
+        "reads": 0,
+        "sequence": "CCCCAACCCAGACCCCGTCTTTTCCTGGTCCGTTCGTATT",
+        "vfam": "VH2"
+      },
+      {
+        "copies": "40",
+        "family": "VH2",
+        "name": "Boldrini-VH2-B",
+        "reads": 0,
+        "sequence": "ACACAGCCACGTATTACTGCCCCTTGGCCTCCTCAATTACGATATTTTGACTGGTTATCCTACTGGGGCCAGGGAACCCT",
+        "vfam": "VH2"
+      },
+      {
+        "copies": "160",
+        "family": "VH2",
+        "name": "Boldrini-VH2-C",
+        "reads": 0,
+        "sequence": "GGACACAGCCACATATTACTGTGCACGGAAGGGACCTTTACGATTTTTGGAGTGGTTATTAGGCCCTCTTACTACGGTATGGACGTCTGGGG",
+        "vfam": "VH2"
+      },
+      {
+        "copies": "10",
+        "family": "VH3",
+        "name": "Boldrini-VH3-A",
+        "reads": 0,
+        "sequence": "ATAGCAGCTCGCTCACAGA",
+        "vfam": "VH3"
+      },
+      {
+        "copies": "40",
+        "family": "VH3",
+        "name": "Boldrini-VH3-B",
+        "reads": 0,
+        "sequence": "AGGTGAGATCGGGG",
+        "vfam": "VH3"
+      },
+      {
+        "copies": "160",
+        "family": "VH3",
+        "name": "Boldrini-VH3-C",
+        "reads": 0,
+        "sequence": "TTACTGTCCTCCCGAACGAACCCCTCCGAACCCCCTATAGCAGCTCGGAGTATGGGTGTCAAACTACTACGGTAT",
+        "vfam": "VH3"
+      },
+      {
+        "copies": "40",
+        "family": "VH4",
+        "name": "Boldrini-VH4-B",
+        "reads": 0,
+        "sequence": "GGGGATGGTCAGTGG",
+        "vfam": "VH4"
+      },
+      {
+        "copies": "160",
+        "family": "VH4",
+        "name": "Boldrini-VH4-C",
+        "reads": 0,
+        "sequence": "TGTATTACTGTGCGAGAAGGGGTATAGCAGCAGCTGGTGCCTACTTTGACTACTGGGGCCAGGGAACCCT",
+        "vfam": "VH4"
+      },
+      {
+        "copies": "10",
+        "family": "VH5",
+        "name": "Boldrini-VH5-A",
+        "reads": 0,
+        "sequence": "GCGAGACGGG",
+        "vfam": "VH5"
+      },
+      {
+        "copies": "40",
+        "family": "VH5",
+        "name": "Boldrini-VH5-B",
+        "reads": 0,
+        "sequence": "CCCTCCGCCACCCTGAGAGCCCACCTGGGGGAGGTTTGA",
+        "vfam": "VH5"
+      },
+      {
+        "copies": "160",
+        "family": "VH5",
+        "name": "Boldrini-VH5-C",
+        "reads": 7282.0,
+        "sequence": "ATGCCAAAACGGGGA",
+        "vfam": "IGHV5"
+      },
+      {
+        "copies": "10",