Commit 4a584959 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: CDR3/JUNCTION, more tests

parent 59849ea2
>TRGV5*01 5/CC/0 TRGJ1*02 [TRG]
>TRGV5*01 5/CC/0 TRGJ1*02 [TRG] {CATWA!YYKKLF}
# Representative first junction Lec Rep01
CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC
# Representative second junction Lec Rep05
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG]
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
>TRGV9*01 8/CTCACGAGGG/3 TRGJP1*01 [TRG]
>TRGV9*01 8/CTCACGAGGG/3 TRGJP1*01 [TRG] {CACLTRATGWFKIF}
CGGCACTGTCAGAAAGGAATCCGGCATTCCGTCAGGCAAATTTGAGGTGGATAGGATACCTGAAACGTCTACATCCACTCTCACCATTCACAATGTAGAGAAACAGGACATAGCTACCTACTACTGTGCCTGTCTCACGAGGGCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# Intron -2/0/-10 KDE ?
......@@ -9,11 +9,11 @@ CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGG
>IGKV3-7*04 1/GTGGA/11 KDE [IGK+]
CCCAGGCTCCTCATCTATGATGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCGTGGAGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG]
>TRGV2*01 9/CCCTGG/1 TRGJP1*01 [TRG] {CATPW!TTGWFKIF}
GGAAGGCCCCACAGCGTCTTCAGTACTATGACTCCTACAACTCCAAGGTTGTGTTGGAATCAGGAGTCAGTCCAGGGAAGTATTATACTTACGCAAGCACAAGGAACAACTTGAGATTGATACTGCGAAATCTAATTGAAAATGACTTTGGGGTCTATTACTGTGCCACCCCCTGGTACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCGCCTGGTAA
# or TRGJ1*01
>TRGV5*01 0/CAGAGG/7 TRGJ1*02 [TRG]
>TRGV5*01 0/CAGAGG/7 TRGJ1*02 [TRG] {CATWDRQRKKLF}
GGAAGGCCCCACAGCGTCTTCTGTACTATGACGTCTCCAACTCAAAGGATGTGTTGGAATCAGGACTCAGTCCAGGAAAGTATTATACTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGACAGGCAGAGGAAGAAACTCTTTGGCAGTGGAACAACAC
# or TRDV2*03
......
......@@ -16,7 +16,7 @@ TACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGTAAG
### IGK: VJ, V-KDE, Intron-KDE
# 1043-IGK
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK]
>IGKV1-5*03 9/4/1 IGKJ1*01 [IGK] {CQQYNRLWTF}
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
# 0119-lil-IGK+-TRA+D-TRD+-TRG
......@@ -47,7 +47,7 @@ gtatgaaagtattacctcccagttgcaatttggcaaaggaaccagagtttccacttctcc
### TRB: VJ, DJ
# 0000-nck-TRB
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB]
>TRBV11-2*01 1/4/0 TRBJ2-7*01 [TRB] {CASSLGPSYEQYF}
AACGGTGTAGTGGATGATTCACAGTTGCCTAAGGATCGATTTTCTGCAGAGAGGCTCAAAGGAGTAGACTCCACTCTCAAGATCCAGCCTGCAAAGCTTGAGGACTCGGCCGTGTATCTCTGTGCCAGCAGCTTAGGTCCCTCGTACGAGCAGTACTTCGGGCCGGGCACCAGGCTC
......@@ -59,7 +59,7 @@ CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATT
### TRG
# 0000-lil-lec-TRG
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG]
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment