Commit 48d9c8ad authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: a clone has slightly changed

taking another clone
parent 0b34828f
......@@ -29,10 +29,10 @@ $ Clones #01 and #02 are clustered (not together): their windows appear two time
2:"CTGTGCGAGAGTGGGCAGCAGCTGGTCTGATGCTTTTGATTATCTGGGGC"
2:"GCGAGAGCGATCCCCCGGTATTACTATGATACTAGTGGCCCAAACGACTA"
$ Clones #03 is not clustered: its windows appear only once .vidjil ('id')
1:"TGTGAGAGAGCGATCCCCCGGTATTACTAGGATACTAGTGGCCCAAACGA"
$ Some other clone is not clustered: its windows appear only once .vidjil ('id')
1:"TGCGATAGCGATCCCGCGGTATTACTATGATACTAGTGGCCCAAACGACT"
$ Clones #01, #02 and #03 have the start of their sequence in .vidjil, on the good strand
$ Clones #01, #02 and other have the start of their sequence in .vidjil, on the good strand
1: "sequence": "ACGCTGGCAATGGTAACACAAAATATTCACAGAAG
1: "sequence": "TAGTGGTGCCATATACTACGCAGACTCTGTGAAGG
1: "sequence": "CATTAGTAGTAATAGTGGTGCCATATACTACGCAG
1: "sequence": "TATACTACGCAGACTCTGTGAAGGGCCGATTCACC
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment