Commit 4866f857 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: same sequence with an even shorter J

parent af09c18a
......@@ -13,3 +13,9 @@ actactttgactactggggccaaggaaccctggtcaccgtctcctcag
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactggggcc
# Same sequence, but with only the 15bp start of J
>IGHV1-18*01 0//0 IGHD3-16*01 0//0 IGHJ4*01
agcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
gtattatgattacgtttgggggagttatgcttatacc
actactttgactactg
\ No newline at end of file
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment