Commit 48160939 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update, unsegmentation causes

opens #4728
parent cb571f04
......@@ -3,9 +3,9 @@
# Sequences outside any V(D)J locus
>too_few_vj-1
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCACCCTGGCACAGGCCAGCAGTTGCTGGAAGTCAGACACCTGTGAAGAAC
CTAGGCATGGCTCCTCTCCACAGGAAAACTCCACTCCAGTGCTCAGCTTGCAaCCTGGCACAGGCCAGCAGTTGaTGGAAGTCcGACACCTGTGAAGAAC
>too_few_vj-2
>too_few_vj-2 #4728
GCCTCAGGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCGCACAGTGCTGGTTCCGTCACCCCCACCCAGGGAAGCAGGTCTGAGCAGCTTGTCCTGGCTG
>too_few_vj-3
......
......@@ -7,8 +7,8 @@ $ Only one sequence is detected, but it is too small for a window (too short w)
$ The proper unsegmentation cause is given
1: UNSEG too short -> .* 1
1: UNSEG strand -> .* 1
1: UNSEG too few V/J -> .* 3
1: UNSEG only V/5' -> .* 1
f1: UNSEG too few V/J -> .* 3
f1: UNSEG only V/5' -> .* 1
1: UNSEG only J/3' -> .* 1
1: UNSEG ambiguous -> .* 1
1: UNSEG too short w -> .* 1
......@@ -16,7 +16,7 @@ $ The proper unsegmentation cause is given
$ The proper cause is given in the .undetected.vdj.fa file (-uuu)
1: >too_short .* UNSEG too short
1: >strand .* UNSEG strand
3: >too_few_vj-..* UNSEG too few V/J
f3: >too_few_vj-..* UNSEG too few V/J
1: >only_V .* UNSEG only V/5'
1: >only_J .* UNSEG only J/3'
1: >ambiguous .* UNSEG ambiguous
......@@ -29,8 +29,8 @@ $ The proper cause is given in the .undetected.vdj.fa file (-uuu)
$ The proper unsegmentation cause is given
1: UNSEG too short -> .* 1
1: UNSEG strand -> .* 1
1: UNSEG too few V/J -> .* 3
1: UNSEG only V/5' -> .* 1
f1: UNSEG too few V/J -> .* 3
f1: UNSEG only V/5' -> .* 1
1: UNSEG only J/3' -> .* 1
1: UNSEG ambiguous -> .* 1
1: UNSEG too short w -> .* 1
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment