Commit 45c430d8 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update, TRGV10*02 has one more nucleotide

parent be705ad3
......@@ -3,6 +3,6 @@
CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC
# Representative second junction Lec Rep05
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
>TRGV10*02 6/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
......@@ -70,7 +70,7 @@ CTGCGCTTCCTGCCGCTGCCcaGTGGTTGGGGGAGGGGGACtaGCAGGGAGGAAACATTTTTGTATcaTGGTGTAACATT
### TRG
# 0000-lil-lec-TRG
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
>TRGV10*02 6/AGAC/3 TRGJP1*01 [TRG] {CAAWRPTGWFKIF}
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment