Commit 44d74052 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: update tests for .affects debug output (-K)

parent 6aef087f
!LAUNCH: ../../vidjil -r 5 -K -g ../../germline ../../data/multi-short.fa ; head -n 15 out/multi-short.affects
!LAUNCH: ../../vidjil -r 5 -K -g ../../germline ../../data/multi-short.fa ; head -n 17 out/multi-short.affects
# Testing .affects output (-K)
$ First sequence (TRA), display sequence
1:TCTTCATTCCTTAGTCGCTCTGATAGTTATGGTTACCTCCTTCTACAGGAGCTCCAGATGAAAGACTCTGCCTCTTACTTCTGCGCTGTGAGAGAGTATGAAAGTATTACCTCCCAGTTGCAATTTGGCAAAGGAACCAGAGTTTCCACTTCTCC
$ First sequence (TRA), count of k-mers
1:.TRA .* 129
1:129 .* TRA
$ First sequence (TRA), segmentation
1:>TRA--V1-1.01--J1.01 .* seed TRA SEG_+
......
!LAUNCH: $LAUNCHER ../../vidjil -k 9 -G ../../germline/IGH -K -c clones ../../data/revcomp.fa ; grep '#IGH' out/revcomp.affects | sed 's/[^X]//g' | awk '{ print length }'
!LAUNCH: $LAUNCHER ../../vidjil -k 9 -G ../../germline/IGH -K -c clones ../../data/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g' | awk '{ print length }'
$ Segments both reads, normal and reverse
1:junction detected in 2 reads
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment