Commit 3ea10278 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: -2 should also works on V-D and D-J recombinations

Opens #2168.
parent abac2be5
!LAUNCH: $VIDJIL_DIR/vidjil $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline -2 $VIDJIL_DIR/data/chimera-fake-D.fa
$ The KmerSegmenter segments the chimera reads on PSEUDO_MAX12 germline (-2)
f1:xxx .* -> .* 2
$ The FineSegmenter gives the locus information (-2)
f1:Unexpected [+]IGHD/[+]TRBJ
f1:Unexpected [+]TRAV/[+]TRDD
$ The FineSegmenter correclty segments the V-D and D-J sequences (-2)
f1:IGHD1-1.01--TRBJ1-1.01
f1:TRAV1-1.01--TRDD3.01
# Fake chimera sequences, (somewhat unprobable) recombinations involving D genes
>IGHD1-1*01--TRBJ1-1*01 (D with upstream)
GGGCGCCGGGGCAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGAC
tgaacactgaagctttctttggacaaggcaccagactcacagttgtag
>TRAV1-1*01--TRDD3*01 (D with downstream)
ggagctccagatgaaagactctgcctcttacttctgcgctgtgagaga
ACTGGGGGATACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTG
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment