Commit 3e8c2399 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: tdd, report unproductivity causes

see #4599
parent 16bb060e
......@@ -7,3 +7,8 @@ gaattattataagaaactctttggcagtggaacaacactggttgtcacag
>TRGV1*01 0/AA/0 TRGJ1*01 [TRG] {CATWDRKNYYKKLF}
ctgcaaaatctaattaaaaaTGAttctgggttctattactgtgccacctgggacaggAA
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
# Not in-frame
>TRGV1*01 0/AAG/0 TRGJ1*01 [TRG] {CATWDRK#NYYKKLF}
ctgcaaaatctaattaaaaaTGAttctgggttctattactgtgccacctgggacaggAAG
gaattattataagaaactctttggcagtggaacaacactggttgtcacag
\ No newline at end of file
!OUTPUT_FILE: out/cdr3-stopcodon.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/cdr3-stopcodon.fa
!OUTPUT_FILE: out/productive_stop_outframe.vidjil
!LAUNCH: $VIDJIL_DIR/$EXEC -c designations -3 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRG $VIDJIL_DATA/productive_stop_outframe.fa
!OPTIONS: --mod jR
$ Two identical junctions in JSON
$ Two identical junctions, and the last one with a spurious nucleotide
:clones[0].seg.junction.aa: CATWDRKNYYKKLF
:clones[1].seg.junction.aa: CATWDRKNYYKKLF
:clones[2].seg.junction.aa: CATWDRK#NYYKKLF
$ But only one productive
:clones[0].seg.junction.productive: False
:clones[1].seg.junction.productive: True
:clones[2].seg.junction.productive: False
$ Cause of unproductivity
:clones[0].seg.junction.unproductive: stop-codon
0:clones[1].seg.junction.unproductive
:clones[2].seg.junction.unproductive: out-of-frame
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment