Commit 3e6ace07 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: for now, stanford-labels-FaW.should_get does not pass with -t 100

This should be investigated.
parent d317535b
!LAUNCH: ../../vidjil -G ../../germline/IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
!LAUNCH: ../../vidjil -t 0 -G ../../germline/IGH -FaW GAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACT ../../data/Stanford_S22.fasta ; cat out/seq/clone.fa-1
$ Keep only one windows, the one given by -W, with only 5 reads (it is actually the second clone in Stanford_S22.fasta)
1: keep 1 windows in 5 reads
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment