Commit 3de642bd authored by Mathieu Giraud's avatar Mathieu Giraud

tests: a Vd-Dd3 sequence from Lille

parent 8b7d13b8
>TRDV2*01 1/33/4 TRDD3*01 [TRD+]
ATACCGAGAAAAGGACATCTATGGCCCTGGTTTCAAAGACAATTTCCAAGGTGACATTGATATTGCAAAGAACCTGGCTGTACTTAAGATACTTGCACCATCAGAGAGAGATGAAGGGTCTTACTACTGTGCCTGTGAGAC
ACAGGCACAGGCACAGTAGTAAGCCCCATATAT
GGGGCTACGCACAGTGCTACAAAACCTACAGAGACCTGTACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCA
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment