Commit 3dd35e59 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/vidjil-algo.md: --out-clone-files

Closes #4386
parent e3c149e8
Pipeline #159777 passed with stages
in 157 minutes and 14 seconds
......@@ -514,7 +514,8 @@ ATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGAC
Windows of size 50 (modifiable by `-w`) have been extracted.
The first window has 8 occurrences, the second window has 5 occurrences.
The `out/seq/clone.fa-*` contains the detailed analysis by clone, with
With the `--out-clone-files` option, one `out/seq/clone.fa-*` file is created for each clone.
It contains the detailed analysis by clone, with
the window, the consensus sequence, as well as with the most similar V, (D) and J germline genes:
``` diff
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment