Commit 3d0d35ab authored by flothoni's avatar flothoni

algo/tests; add alignment for 2 sequences with D that appear since the last release

Link to #4267
parent 3598f91c
Pipeline #153024 failed with stages
in 30 minutes and 1 second
......@@ -5,12 +5,3 @@ TCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCC
TGGGGGTACGATTTTTGGAGTGGTTATCCCAGACC
CTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
### Cases from Lille ###
# In this case, the second D found match on only 8nt (on 31)
# gtattatgatt TTTGGACT ggttattatacc
# the 3 last nt are identical to the J start, so we can consider that it is in fact only 5 nt long (with a strech of T ?)
>IGHV1-2*02 18//3 IGHD2-2*02 1/AATTTGG/3 IGHJ4*02 [IGH]
GGAGTCGGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCCTATATTGTAGTAGTACCAGCTGCTATACAATTTGGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# In this case, the D found (GGGGGAT, 7nt/13) have a strech of G(5x)and 2 other nt.
>TRDV1*01 2/GTAAAACGTGAGGGGGATC/0 TRDJ1*01 [TRD]
ATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAAGTAAAACGTGAGGGGGATCACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
### Cases from Lille ###
# In this case, the second D found match on only 8nt (on 31)
# gtattatgatt TTTGGACT ggttattatacc
# the 3 last nt are identical to the J start, so we can consider that it is in fact only 5 nt long (with a strech of T ?)
# IGHV1-2*02 18//3 IGHD2-2*02 1/AA/11 IGHD3/OR15-3a*01 12//3 IGHJ4*02
# IGHV1-2*02 ACGACACGGCCgTgtattactgtgcgagaga
# |||||||||||.|..................
# seq ACGACACGGCCCTATATTGTAGTAGTACCAGCTGCTATACAATTTGGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# ...|||||||||||||||||||||||||||.
# IGHD2-2*02 aggATATTGTAGTAGTACCAGCTGCTATACc
# ...........||||||||............
# IGHD3/OR15-3a*01 gtattatgattTTTGGACTggttattatacc
# ||||||||||||||||||||||||||||||||||||||||||||||||
# IGHJ4*02 ACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG
# Old VDJ > IGHV1-2*02 18//3 IGHD2-2*02 1/AATTTGG/3 IGHJ4*02
>IGHV1-2*02 18//3 IGHD2-2*02 1/AA/11 IGHD3/OR15-3a*01 12//3 IGHJ4*02 [IGH]
GGAGTCGGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCCTATATTGTAGTAGTACCAGCTGCTATACAATTTGGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGGTAAG
# In this case, the D found (GGGGGAT, 7nt/13) have a strech of G(5x)and 2 other nt.
# TRDV1*01 ACTTTTGTGCTCTTGGGGAAcT
# ||||||||||||||||||||.|
# sequence ACTTTTGTGCTCTTGGGGAAGTAAAACGTGAGGGGGATCACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
# ...|||||||...
# TRDD3*01 actgggggatacg
# ||||||||||||||||||||||||||||||||||||||||||||||||
# TRDJ1*01 acaccgataaactcatctttggaaaaggaacccgtgtgactgtggaac
# Old VDJ > TRDV1*01 2/GTAAAACGTGAGGGGGATC/0 TRDJ1*01
>TRDV1*01 2/GTAAAACGTGA/3 TRDD3*01 3/C/0 TRDJ1*01 [TRD]
ATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTGGGGAAGTAAAACGTGAGGGGGATCACACCGATAAACTCATCTTTGGAAAAGGAACCCGTGTGACTGTGGAAC
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment