Commit 3a045704 authored by Mathieu Giraud's avatar Mathieu Giraud

tests: test segmentation in json output

parent 7d1e0689
!REQUIRES: python ../../tools/check_python_version.py !REQUIRES: python ../../tools/check_python_version.py
!LAUNCH: ../../vidjil -z 0 -G ../../germline/IGH -w 60 -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1 !LAUNCH: ../../vidjil -z 1 -G ../../germline/IGH -w 60 -r 5 -b data ../../data/Stanford_S22.fasta ; cat out/data.vidjil | python ../../tools/format_json.py -1
$ Number of reads $ Number of reads
e1:"total": [13153] e1:"total": [13153]
...@@ -9,3 +9,6 @@ e1:"segmented": [13153] ...@@ -9,3 +9,6 @@ e1:"segmented": [13153]
$ Most abundant window $ Most abundant window
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\] 1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
$ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment