Commit 36eecdad authored by flothoni's avatar flothoni

watir; minor fix of depreciation

Use array to locate multiple classes elements
parent 112bf0a2
Pipeline #159823 passed with stages
in 12 minutes and 26 seconds
......@@ -58,7 +58,7 @@ class ExternalTest < BrowserTest
$b.until { $b.segmenter_checkbox_imgt_vdj.present? }
clone_info = $b.clone_info_segmenter('25')
productive_title = clone_info[:axis].element(:class => 'productivity IMGT').title
productive_title = clone_info[:axis].element(:class => ['productivity', 'IMGT']).title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('25')
......
......@@ -31,7 +31,7 @@ GGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACAT
Watir::Wait.until(timeout: 10) { $b.span(:class => "identityBad").exists? }
clone_info = $b.clone_info_segmenter('0')
clone_info[:identity].element(:text => "NaN%").wait_while(&:present?)
productive_title = clone_info[:axis].element(:class => 'productivity IMGT').title
productive_title = clone_info[:axis].element(:class => ['productivity', 'IMGT']).title
assert (productive_title.include? 'productivity'), "IMGT should tell us the productivity of the sequence"
clone_segmenter = $b.clone_in_segmenter('0')
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment