Commit 35ce382a authored by Mathieu Giraud's avatar Mathieu Giraud

should-vdj: BRI_TRB, alternative N regions

2 sequences with 3 or 4 exact nucleotides after the mutation
parent 2d028fcc
......@@ -68,11 +68,14 @@ CTCTGGGGCCAACGTCCTGACTTTCGGGGCCGGCAGCAGGCTGACCGTGCTGGGCGAG
#target 1272BP
>TRBV21-1*01 4/TACTGGGAG/5 TRBD2*02 1/6/5 TRBJ2-7*01 [TRB]
# D2*02/5: gggaCtagcgg
>TRBV21-1*01 (4/TACTGGGAG/5, 4/TACTG/0) TRBD2*02 1/6/5 TRBJ2-7*01 [TRB]
GTATCGTAAGAAGCTGGAAGAAGAGCTCAAGTTTTTGGTTTACTTTCAGAA
TGAAGAACTTATTCAGAAAGCAGAAATAATCAATGAGCGATTTTTAGCCCAATGCTCCAAAAACTCATCCTG
TACCTTGGAGATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCAT
ACTGGGGAGTAGCGGGAGGTTCAGGACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
TACCTTGGAGATCCAGTCCACGGAGTCAGGGGACACAGCACTGTATTTCTGTGCCAGCAGCATACTGGGGAG
tagcgg
GAGGTT
CAGGACGAGCAGTACTTCGGGCCGGGCACCAGGCTCACGGTTACAGGTAAG
#target 1297RC
......@@ -83,11 +86,13 @@ TACACAGATACGCAGTATTTTGGCCCAGGCACCCGGCTGACAGTGCTCGGTGTGCGCG
#target 1323DS
>TRBV5-1*01 0/TCCAC/8 TRBJ1-1*01 [TRB]
#4/TRBJ1-1*01: cacTgaagctttcttt...
>TRBV5-1*01 (0/TCCAC/8, 0/TC/4) TRBJ1-1*01 [TRB]
CAGTGTGTCCTGGTACCAACAGACCCCAGGACAGGGCCTTCAGTTCCTCTTTGAATACTTCAGTGAGACACA
GAGAAACAAAGGAAACTTCCCTGGTCGATTCTCAGGGCGCCAGTTCTCTAACTCTCGCTCTGAGATGAATGT
GAGCACCTTGGAGCTGGGGGACTCGGCCCTTTATCTTTGCGCCAGCAGCTTGGTCCAC
GAAGCTTTCTTTGGACAAGGCACCAGA
GAGCACCTTGGAGCTGGGGGACTCGGCCCTTTATCTTTGCGCCAGCAGCTTGG
TC
cacGAAGCTTTCTTTGGACAAGGCACCAGA
#target 1323DS
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment