Attention une mise à jour du service Gitlab va être effectuée le mardi 14 décembre entre 13h30 et 14h00. Cette mise à jour va générer une interruption du service dont nous ne maîtrisons pas complètement la durée mais qui ne devrait pas excéder quelques minutes.

Commit 33bb566b authored by Thonier Florian's avatar Thonier Florian
Browse files

numerical_axis.js : add unit tests on position of labels.

parent b5b2f4fc
......@@ -92,8 +92,27 @@ QUnit.test("axis", function(assert) {
assert.equal(axis.pos(m.clone(0)).pos.toPrecision(3), 0.00, "custom : clone 0 (nlength = 0) position -> 0.00")
assert.equal(axis.pos(m.clone(1)).pos.toPrecision(3), 0.257, "custom : clone 1 (nlength = 9) position -> 0.30")
//sequenceLength
axis = new NumericalAxis(m)
axis.init(m.clones,
function(clone) {
return clone.getSequenceLength();
},
undefined,
false)
assert.equal(axis.pos(m.clone(0)).pos.toPrecision(3), 0.0325, "custom 2 : clone 0 (sequenceLength = 21) position -> 0.0325")
assert.equal(axis.pos(m.clone(1)).pos.toPrecision(3), 0.0236, "custom 2 : clone 1 (sequenceLength = 18) position -> 0.0236")
assert.equal(axis.pos(m.clone(3)).pos.toPrecision(3), 0.683, "custom 2 : clone 3 (sequenceLength = 241) position -> 0.683")
assert.equal(axis.label_mapping.hasOwnProperty('0'), false, "axis have not label 0")
assert.equal(axis.label_mapping.hasOwnProperty('10'), true, "axis have label 10")
assert.equal(axis.label_mapping.hasOwnProperty('281'), true, "axis have label 281")
assert.equal(axis.label_mapping['10'].pos.toPrecision(3), 0, "pos of axis.label 10 is 0")
assert.equal(axis.label_mapping['281'].pos.toPrecision(3), 0.8000, "pos of axis.label 281 is 0.8")
assert.equal(axis.labels[0].pos, 1, "pos of axis label 0 ('?' value) is 1")
assert.notEqual(axis.labels[axis.labels.length-1-1].pos, 1, "pos of last axis label is not 1")
//gc
axis = new PercentAxis(m, false, false);
axis.init(m.clones, 'GCContent', undefined, false, 0, 1)
......
......@@ -50,7 +50,13 @@ json_data = {
"3start" : 6,
"5end" : 5,
"cdr3" : {"start": 5, "stop": 6, aa: "AG"}
}
},
"_average_read_length": [
21
],
"_coverage": [
1
]
},
{
"sequence" : "cccccgtcccccccatca",
......@@ -65,7 +71,13 @@ json_data = {
"3start" : 15,
"5end" : 5,
"fr1" : {"start" :2, "stop":5}
}
},
"_average_read_length": [
18
],
"_coverage": [
1
]
},
{
"sequence" : "cccccccccccccccccccc",
......@@ -80,7 +92,13 @@ json_data = {
"3" : "IGHJ6*01",
"3start" : 15,
"5end" : 5
}
},
"_average_read_length": [
20
],
"_coverage": [
1
]
},
{
"id": "id4",
......@@ -184,7 +202,13 @@ json_data = {
"JUNCTION (AA)": "CATWDRLKDWIKTF",
"JUNCTION (AA) (with frameshift)": ""
},
}
},
"_average_read_length": [
241
],
"_coverage": [
1
]
},
{
"sequence" : "catcatcatgatgctacgatcttac",
......@@ -197,7 +221,10 @@ json_data = {
"seg" : {
"f1" : {"start": 4, "stop": 7},
"f2" : {"seq": "tacgat"}, // 15 -> 20
}
},
"_average_read_length": [
undefined
],
}
]
};
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment