Commit 32ceb85b authored by Mathieu Giraud's avatar Mathieu Giraud

tests: segment_simul.fa may have a double D

Back in april 2013, when @mikael-s designed this simulated sequence,
he premonitorily included a borderline case of a VDDJ recombination.
There are here 6-7 nucleotides exactly conserved for the second D.
parent cbeb3b0c
......@@ -8,9 +8,14 @@ $ First sequence, easy segmentation (no error, few deletions at the windows, sma
# |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
# V5-10-1: 280 attactgtgcgaga |||||||||||||
# D1-14*01: 1 ggtataaccggaaccac
# |||||||
# D3-16*01: gtattatgattacgtttgggggaGTTATGcttatacc
# J5*01 : 1 acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
# -2/CTTC/-3 -1/GTTA/5
1:^>seq1 \\+ VDJ 0 72 77 89 94 139 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
# Note that a second D (D3-16*01) can be detected (6 common nucleotides, or even 7 with an overlap on the first D)
# This is tested in segment_simul.should-vdj
$ seq1_polyT is the same as seq1 but starts and ends with 10Ts, the recombination is in the middle. start position should not be 0 and end position should not be length-1
f1:^>seq1_polyT \\+ VDJ 10 82 87 99 104 149 IGHV5-10-1.0[1-4] 2/CTTC/3 IGHD1-14.01 1/GTTA/5 IGHJ5.01
### Copied from data/segment_simul.fa and algo/tests/segment_simul.should_get
# See algo/tests/segment_simul.should_get for a detailed description
# With only one D, this is:
# IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1/GTTA/5 IGHJ5*01 [IGH]
>IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1/GTTA/5 IGHJ5*01 [IGH]
>IGHV5-10-1*01 2/CTTC/3 IGHD1-14*01 1//23 IGHD3-16*01 8//7 IGHJ5*01 [IGH]
aagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcga
CTTC
ataaccggaacca
GTTA
tggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
TG
gttcgactcctggggccaaggaaccctggtcaccgtctcctcag
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment