Commit 32aaa23d authored by Mathieu Giraud's avatar Mathieu Giraud

tests: json output, seg.5/4/3 values should be 1-based

We should follow format-analysis.org specification: "Positions on the sequence start at 1."
Note that these tests were introduced in 745b47db (Feb 2016), but, at this time, we did not check these positions.
parent c4763000
......@@ -10,17 +10,30 @@ e1:"segmented": [13153]
$ Most abundant window
1:"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC".*"reads": \\[8\\]
$ Affect values are over all the sequence
1: "affectValues": .[^}]*"start": 1, "stop": 128
$ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
# 1 2 3 4 5 * 6 7 * 8 ** 9 10 11 12
# 12345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678
# 5-----------------------------------------------------5N----------------ND----------DJ-----------------------------------------J
# GCTGTACCTGCAAATGAACAGCCTGCGAGCCGAGGACACGGCCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCCAGGGGATCCTGGTCACCGTCTCCTCAG
# ACCCGGGAGGAACAATAT
# agcagctggtac
# 5(V): 1 -> 55
# 4(D): 74 -> 85
# 3(J): 86 -> 128
$ Segmentation details - V
1:"5": ."delRight": 6, "end": 54, "name": "IGHV3-23.05".
1:"5": ."delRight": 6, "end": 55, "name": "IGHV3-23.05".
$ Segmentation details - D
1:"4": ."delLeft": 9, "delRight": 0, "end": 84, "name": "IGHD6-13.01", "start": 73.
1:"4": ."delLeft": 9, "delRight": 0, "end": 85, "name": "IGHD6-13.01", "start": 74.
$ Segmentation details - J
1:"3": ."delLeft": 5, "name": "IGHJ4.02", "start": 85.
1:"3": ."delLeft": 5, "name": "IGHJ4.02", "start": 86.
$ Segmentation details - N1, N2
1:"N1": 18,
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment