Commit 31e96621 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

format-analysis.org: put actual segmentation data for example

parent 8f04763e
......@@ -21,6 +21,7 @@ present in the =.vidjil= file.
** =.vidjil= file -- one sample
This is a kind a minimal =.vidjil= file, describing clones in one sample.
The segmentation is here =TRGV5*01 5/CC/0 TRGJ1*02=.
Note that other elments could be added by some program (such as =tag= or =clusters=).
#+BEGIN_SRC js
......@@ -46,12 +47,12 @@ Note that other elments could be added by some program (such as =tag= or =cluste
"clones": [
{
"id": "clone-001",
"sequence": "ATGACTCTGGAGTCTATTACTGTGCCACCTGGGATGTGAGTATTATAAGAAAC",
"reads" : [ 243241 ]
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241 ],
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 57,
"3": "TRGJ1*02", "3start": 59, "3end": 80
"5": "TRGV5*01", "5start": 0, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118
}
} // ,
......@@ -88,14 +89,13 @@ Clones that have a same =id= are gathered.
"clones": [
{
"id": "clone-001",
"sequence": "ATGACTCTGGAGTCTATTACTGTGCCACCTGGGATGTGAGTATTATAAGAAAC",
"reads" : [ 243241, 14717 ]
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241, 14717 ],
"seg":
{
"5": "TRGV5*01", "5start": 0, "5end": 57,
"3": "TRGJ1*02", "3start": 59, "3end": 80
"5": "TRGV5*01", "5start": 0, "5end": 86,
"3": "TRGJ1*02", "3start": 89, "3end": 118
}
} // ,
// (other clones)
]
......
Supports Markdown
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment