Merge branch 'feature-a/4665-v-d-kmers' into 'dev'

fix typos, show D seeds, bikeshed .affects

Closes #4727 and #4338

See merge request !932

algo/core/filter.cpp

@@ -182,7 +182,8 @@ ostream &operator<<(ostream &out, const FilterWithACAutomaton& obj){
   int total_sequences_origin = total_filtered_calls * origin_bioreader_size;
   float aligned_rate = ((float)total_sequences_filtered/(float)total_sequences_origin) * 100;
 
-  out << fixed << setw(8) << total_sequences_filtered << "/"
+  out << right
+      << fixed << setw(8) << total_sequences_filtered << "/"
       << fixed << setw(8) << total_sequences_origin << "    "
       << fixed << setprecision(1) << setw(6) << aligned_rate << "%"
       << endl ;

algo/core/germline.cpp

@@ -230,23 +230,33 @@ Germline::~Germline()
     }
 }
 
+void out_index_seed(ostream &out,
+               const Germline &germline,
+               string seed_x,
+               string affect_x)
+{
+  size_t seed_x_span = seed_x.size();
+
+  out << " " << fixed << setprecision(3) << setw(5)
+      << 100 * germline.index->getIndexLoad(KmerAffect(affect_x, 1, seed_x_span)) << "%"
+      << " l" << left << setw(2) << seed_x.length()
+      << " k" << left << setw(2) << seed_weight(seed_x)
+      << " " << left << setw(15) << seed_x ;
+
+}
+
 ostream &operator<<(ostream &out, const Germline &germline)
 {
   out << setw(5) << left << germline.code << right << " '" << germline.shortcut << "' "
       << " ";
 
-  size_t seed_5_span = germline.seed_5.size();
-  size_t seed_5_w = seed_weight(germline.seed_5);
-  size_t seed_3_span = germline.seed_3.size();
-  size_t seed_3_w = seed_weight(germline.seed_3);
-
   if (germline.index) {
     out << " 0x" << hex << setw(2) << setfill('0') << germline.index->id << dec << setfill(' ') << " " ;
-    out << fixed << setprecision(3) << setw(8)
-        << 100 * germline.index->getIndexLoad(KmerAffect(germline.affect_5, 1, seed_5_span)) << "%" << " "
-        << 100 * germline.index->getIndexLoad(KmerAffect(germline.affect_3, 1, seed_3_span)) << "%";
-    out << " l" << germline.seed_5.length() << " k" << seed_5_w << " " << germline.seed_5 ;
-    out << " l" << germline.seed_3.length() << " k" << seed_3_w << " " << germline.seed_3 ;
+
+    out_index_seed(out, germline, germline.seed_5, germline.affect_5);
+    if (germline.rep_4.size())
+      out_index_seed(out, germline, germline.seed_4, germline.affect_4);
+    out_index_seed(out, germline, germline.seed_3, germline.affect_3);
   }
 
   out << endl;

algo/core/segment.cpp

@@ -431,13 +431,20 @@ string KmerSegmenter::getInfoLineWithAffects() const
 {
    stringstream ss;
 
-   ss << "# "
+   ss << "= " << right << setw(10) << segmented_germline->code << " "
       << right << setw(3) << score << " "
       << left << setw(30)
-      << getInfoLine() ;
+      << getInfoLine();
 
    if (getSegmentationStatus() != UNSEG_TOO_SHORT)
-     ss << getKmerAffectAnalyser()->toString();
+   {
+     ss << endl;
+     ss << "# " << right << setw(10) << segmented_germline->code << " "
+        << getKmerAffectAnalyser()->toStringValues();
+     ss << endl;
+     ss << "$ " << right << setw(10) << segmented_germline->code << " "
+        << getKmerAffectAnalyser()->toStringSigns();
+   }
 
    return ss.str();
 }

algo/core/similarityMatrix.cpp

@@ -118,6 +118,7 @@ JsonOutputWindowsMatrix::JsonOutputWindowsMatrix(SimilarityMatrix &m, float sim,
 
 ostream &operator<<(ostream &out, const RawOutputSimilarityMatrix &outputMatrix) {
   SimilarityMatrix &matrix = outputMatrix.matrix;
+  out << right;
   out << "    | " ;
 
   for (int num = 0; num <  matrix.size(); num++) 

algo/core/tools.cpp

@@ -88,10 +88,10 @@ string fixed_string_of_float(float number, int precision)
    return ss.str();
 }
 
-string scientific_string_of_double(double number)
+string scientific_string_of_double(double number, int precision)
 {
    stringstream ss;
-   ss << scientific << number ;
+   ss << scientific << setprecision(precision) << number ;
    return ss.str();
 }
 

algo/core/tools.h

@@ -128,7 +128,7 @@ bool pair_occurrence_sort(pair<T, int> a, pair<T, int> b);
 
 string string_of_int(int number, int pad_to_width=0);
 string fixed_string_of_float(float number, int precision);
-string scientific_string_of_double(double number);
+string scientific_string_of_double(double number, int precision=2);
 string string_of_map(map <string, string> m, const string &before);
 
 /**

algo/core/windowExtractor.cpp

@@ -53,7 +53,9 @@ WindowsStorage *WindowExtractor::extract(OnlineBioReader *reads,
     nb_reads++;
 
     if (out_affects) {
-      *out_affects << reads->getSequence();
+      Sequence seq = reads->getSequence();
+      *out_affects << ">" << seq.label << endl
+                   << setw(13) << " " << seq.sequence << endl;
     }
     
     KmerMultiSegmenter kmseg(reads->getSequence(), multigermline, out_affects, nb_expected, nb_reads_for_evalue);
@@ -114,7 +116,7 @@ WindowsStorage *WindowExtractor::extract(OnlineBioReader *reads,
 
     // Last line of detailed affects output
     if (out_affects) {
-      *out_affects << "#>" << seg->label << " " <<  seg->getInfoLine() << endl << endl;
+      *out_affects << "==> " << seg->label << " " << seg->getInfoLine() << endl << endl;
     }
 
     // Progress bar
@@ -125,7 +127,9 @@ WindowsStorage *WindowExtractor::extract(OnlineBioReader *reads,
 	cout << "." ;
 
 	if (!(nb_reads % (PROGRESS_POINT * PROGRESS_LINE)))
-	  cout << setw(10) << nb_reads / 1000 << "k reads " << fixed << setprecision(2) << setw(14) << bp_total / 1E6 << " Mbp" << endl ;
+	  cout << right
+         << setw(10) << nb_reads / 1000 << "k reads "
+         << fixed << setprecision(2) << setw(14) << bp_total / 1E6 << " Mbp" << endl ;
 
 	cout.flush() ;
       }

algo/tests/bugs/bug4225.should

 !OUTPUT_FILE: out/bug4225-j.affects
-!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
+!LAUNCH: $VIDJIL_DIR/$EXEC -c windows -g $VIDJIL_DIR/germline -r 1 -1 -2 -K bug4225-j.fa
+
+$ Show name and sequence
+1:>igkj1
+1:GTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC
+
+$ Display three lines per system
+3:TRG
+3:IGH\+
 
 $ Find only +k and ? affects before the stretch of _ for all loci
-16: seed .*(\+k| \?){28}( _)+$
+16:^\#.* (k|\?){28}_+$
+16:^\$.* (\+| ){28}( )+$
 
 !OUTPUT_FILE: out/chimera-fake-half.affects
-!LAUNCH: $VIDJIL_DIR/$EXEC -g $VIDJIL_DIR/germline -r 1 -4 -K ../data/chimera-fake-half.fa
+!LAUNCH: $VIDJIL_DIR/$EXEC -c windows -g $VIDJIL_DIR/germline/homo-sapiens.g:TRB -r 1 -4 -K ../data/chimera-fake-half.fa
+
+$ Find only 48 +B affects on the TRB and unexpected lines
+2:^\#.* (_){40}(B){48}(_){10}
+2:^\$.* (\s){40}(\+){48}(\s){10}
 
-$ Find only +B and ? affects on the TRB and unexpected lines
-2: seed .* _(\+B| \?){48} _

algo/tests/should-get-tests/analysis-S22.should

@@ -13,8 +13,8 @@ $ Parses IGHD.fa germline
 $ Parses germline/homo-sapiens/IGHJ.fa
 1: 701 bp in  13 sequences
 
-$ Find the good index load
-1:custom .*  0.078% 0.002% l13 k12
+$ Find the good index loads
+1:custom .* 0.078% l13 k12 .* 0.002% l13 k12
 
 $ Find approximately the good number of sequences for e-value computation
 1: approx. 131.. sequences

algo/tests/should-get-tests/common-V-D.should

@@ -4,7 +4,8 @@ $ Segments the sequence
 1: SEG  .* -> .* 1 
 
 $ Find the good affects for the D segment, including a AMBIGUOUS k-mer, common with V
-1:_ _ _ \?.f.f.f.f.f.f _ _ _ _
+1:___\?ffffff____
+1:   \+\+\+\+\+\+
 
 $ The windows found by the KmerSegmenter has a fairly good position
 2: 1 163 180 220

algo/tests/should-get-tests/filter.should

@@ -4,6 +4,6 @@
 $ Clone 13 is correctly analyzed
 1:FLN1FA001EP9M2.* IGHV2-26.* 2/GAT.*GCC/8 IGHJ2
 
-$ Statistics on -Z
-1:Statistics on clone analysis
+$ Statistics on --analysis-filter
+1:Statistics on filtered genes for clone analysis
 rb1: IGH 3[0-2][0-9]{2}/ 1[0-2][0-9]{3} 28..%
\ No newline at end of file

algo/tests/should-get-tests/multi-short-affects.should

-!LAUNCH: $VIDJIL_DIR/$EXEC -r 5 -K -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa ; head -n 17 out/multi-short.affects
+!OUTPUT_FILE: out/multi-short.affects
+!LAUNCH: $VIDJIL_DIR/$EXEC -r 5 -K --first-reads 1 -g $VIDJIL_DIR/germline/homo-sapiens.g:TRA,TRB,TRD,TRG,IGH,IGK,IGL $VIDJIL_DATA/multi-short.fa
 # Testing .affects output (-K)
 
 $ First sequence (TRA), display sequence
@@ -7,8 +8,8 @@ $ First sequence (TRA), display sequence
 $ First sequence (TRA), count of k-mers
 1:129 .* TRA
 
-$ First sequence (TRA), segmentation
-1:>TRA--V1-1.01--J1.01 .* seed TRA SEG_+
+$ First sequence (TRA), detection
+1:==> TRA--V1-1.01--J1.01 .* seed TRA SEG_+
 
 
 

algo/tests/should-get-tests/revcomp.should

-!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa  -K -c clones $VIDJIL_DATA/revcomp.fa ; grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g'  | sort -u ; grep '#>'  out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
+!LAUNCH: $LAUNCHER $VIDJIL_DIR/$EXEC $EXTRA -k 9 -V $VIDJIL_DIR/germline/homo-sapiens/IGHV.fa -J $VIDJIL_DIR/germline/homo-sapiens/IGHJ.fa  -K -c clones $VIDJIL_DATA/revcomp.fa
+!NO_LAUNCHER:
+!LAUNCH: grep 'X.X.X' out/revcomp.affects | sed 's/[^X]//g'  | sort -u
+!LAUNCH: grep '==>'   out/revcomp.affects | sed 's/.*SEG.../e-value:/' | cut -f 1 -d' '
 
 $ Segments both reads, normal and reverse
 1:junction detected in 2 reads

algo/vidjil.cpp

@@ -427,7 +427,7 @@ int main (int argc, char **argv)
 
   bool keep_unsegmented_as_clone = false;
   app.add_flag("--not-analyzed-as-clones", keep_unsegmented_as_clone,
-               "consider not analyzed reads as clones, taking for junction the complete sequence, to be used on very small datasets (for example --not-analyzed-as-clones -AX 20)")
+               "consider not analyzed reads as clones, taking for junction the complete sequence, to be used on very small datasets (for example --not-analyzed-as-clones --all -X 20)")
     -> group(group) -> level();
 
 
@@ -855,7 +855,7 @@ int main (int argc, char **argv)
   if (max_clones == NO_LIMIT_VALUE || max_clones > WARN_MAX_CLONES)
     {
       cout << endl
-	   << "* WARNING: " << PROGNAME << " was run with '-A' option or with a large '-z' option" << endl ;
+	   << "* WARNING: " << PROGNAME << " was run with '--all' option or with a large '--max-designations/-z' option" << endl ;
     }
   
   if (command == CMD_SEGMENT)
@@ -1335,7 +1335,7 @@ int main (int argc, char **argv)
     if (sort_clones.size() == 0)
       {
 	cout << "  ! No clones with current parameters." << endl;
-	cout << "  ! See the 'Limits to report a clone' options (-r, --ratio, -z, -A)." << endl;
+	cout << "  ! See the 'Limits to report and to analyze clones' options (-r, --min-ratio, -z, --all)." << endl;
       }
     else
       {
@@ -1458,7 +1458,7 @@ int main (int argc, char **argv)
             {
               cout << "." ;
               if (!(num_clone % (PROGRESS_POINT_CLONES * PROGRESS_LINE)))
-              cout << setw(10) << num_clone / 1000 << "k clones " << endl;
+              cout << right << setw(10) << num_clone / 1000 << "k clones " << endl;
               cout.flush() ;
             }
         }
@@ -1518,7 +1518,7 @@ int main (int argc, char **argv)
         output.addClone(it->first, clone);
         clone->set("sequence", kseg->getSequence().sequence);
         clone->set("_coverage", { repComp.getCoverage() });
-        clone->set("_average_read_length", { windowsStorage->getAverageLength(it->first) });
+        clone->set("_average_read_length", { fixed_string_of_float(windowsStorage->getAverageLength(it->first), 2) });
         clone->set("_coverage_info", {repComp.getCoverageInfo()});
         //From KmerMultiSegmenter
         kseg->toOutput(clone);
@@ -1857,7 +1857,7 @@ int main (int argc, char **argv)
 
   //$ Output statistics on filter()
   if (verbose && (kmer_threshold != NO_LIMIT_VALUE)) {
-    cout << "Statistics on clone analysis (-Z):" << endl;
+    cout << "Statistics on filtered genes for clone analysis (--analysis-filter):" << endl;
     for(list<Germline*>::const_iterator it = multigermline->germlines.begin(); it != multigermline->germlines.end(); ++it){
       FilterWithACAutomaton *f =  (*it)->getFilter_5();
       if (f)