Commit 30c16f63 authored by Mikaël Salson's avatar Mikaël Salson Committed by Mathieu Giraud
Browse files

algo/tests: Bad filtering with -Z 1

Sequece aligned with -Z 1 is IGHV4-59*06 while it should be IGHV4-31*0[23].

IGHV4-59*06 is a pretty good choice for this sequence as it has 100% identity
however it is 4nt shorter compared to IGHV4-31*0[23] (which also have 100% identity).

Example for #3344.
parent 5d2c0f4d
>lclKFLN1FA002R16XT.1
gcctggagtggattgggtacatctattacagtgggagcacctactacaacccgtccctcaagagtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagaggggtggggtattgtagtggtggtagctgctaccctgatgcttttgatatctggggccaagggacaatggtcaccgtctcctcag
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -c segment -g $VIDJIL_DIR/germline/homo-sapiens.g -Z 1 $VIDJIL_DATA/3344-bad-filtering.fa
$ Check that proper filtering is used
1: IGHV4-31*02
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment