Commit 3077fe7e authored by Mikaël Salson's avatar Mikaël Salson
Browse files

should-get: Better test of .vidjil output

Make sure that sequence is output (and evalue) even when we have no FineSegmentation
parent 3148ce2d
......@@ -12,3 +12,9 @@ $ Most abundant window
$ Segmentation
1:"name": "IGHV3-23.05 6/ACCCGGGAGGAACAATAT/9 IGHD6-13.01 0//5 IGHJ4.02"
$ Second sequence has a DNA sequence provided
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"sequence": "[ACGT]+",
$ Second sequence also has evalues
1:"id": "CTGTGCGAGAGGTTACTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTA".*"_evalue": "[0-9\.e-]+"
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment