Commit 3005ee58 authored by Mathieu Giraud's avatar Mathieu Giraud Committed by Marc Duez
Browse files

algo.org: 'out/segmented.vdj.fa' and new option '-U'

parent 0644f019
......@@ -106,11 +106,12 @@ require the =-G germline/IGH= and the =-d= options.
#+BEGIN_SRC sh
./vidjil -G germline/IGH -d data/Stanford_S22.fasta
# Extract (with an ultra-fast heuristic) all windows
# Results are in out/segmented.vdj.fa, which is a FASTA file
# embedding heuristic information in the headers
# ('.vdj' format, see warning below)
# Summary of windows is also available in out/vidjil.data
# Summary of windows is available in out/vidjil.data
# ('.data' format, see below)
# To have detailed/debug results in out/segmented.vdj.fa
# (which is a FASTA file embedding heuristic information
in the headers, '.vdj' format, see warning below)
# run Vidjil with option '-U'
#+END_SRC
#+BEGIN_EXAMPLE
......@@ -136,8 +137,9 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
# - on the standard output
# - in out/clones.vdj.fa (fasta file to be processed by other tools)
# - in out/vidjil.data (for the browser)
# Additional files are in out/segmented.vdj.fa, out/seq/windows.fa-* and out/seq/clone.fa-*
# out/segmented.vdj.fa list segmented reads using the .vdj format (see below)
# Additional files are in out/seq/windows.fa-* and out/seq/clone.fa-*
# If one adds the '-U' option, an additonal out/segmented.vdj.fa file is produced,
# listing segmented reads using the .vdj format (see below)
#+END_SRC
#+BEGIN_SRC sh
......@@ -163,7 +165,7 @@ CTATGATAGTAGTGGTTATTACGGGGTAGGGCAGTACTACTACTACTACATGGACGTCTG
Vidjil output includes segmentation of V(D)J recombinations. This happens
in the following situations:
- in a first pass, in =segmented.vdj.fa= file.
- in a first pass, when requested with =-U= option, in =segmented.vdj.fa= file.
The goal of this ultra-fast segmentation, based on a seed
heuristics, is only to locate the w-window overlapping the
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment