Commit 2ff69a13 authored by Mathieu Giraud's avatar Mathieu Giraud

doc/format-analysis.org: fix previous commit

parent fa97350f
......@@ -69,7 +69,7 @@ or =clusters=, to further cluster some clones, see below).
"id": "clone-001",
"sequence": "CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC",
"reads" : [ 243241 ],
"_average_read_length": 119.3,
"_average_read_length": [ 119.3 ],
"germline": "TRG",
"top": 1,
"seg":
......
Markdown is supported
0%
or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment