Commit 2f7250ef authored by Mikaël Salson's avatar Mikaël Salson
Browse files

stanford-fuse.should_get: point doesn't exist in .vidjil format

The format has evolved. Test updated accordingly
parent 27f797be
!LAUNCH: ../../vidjil -G ../../germline/IGH ../../data/Stanford_S22.fasta ; python ../../tools/fuse.py out/Stanford_S22.vidjil out/Stanford_S22.vidjil -o out/fused.data ; cat out/fused.data | python ../../tools/format_json.py
$ Points list
1:"point": [ "", "" ]
e1:"original_names": ["../../data/Stanford_S22.fasta", "../../data/Stanford_S22.fasta"]
$ Most abundant window, twice, fused
1:"reads": \\[8, 8\\].*"id": "CCACCTATTACTGTACCCGGGAGGAACAATATAGCAGCTGGTACTTTGACTTCTGGGGCC"},.*"top": 2
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment