Commit 2e60c676 authored by Tatiana Rocher's avatar Tatiana Rocher

test for IGK, IGK+, Intron/KDE added

parent 254c991d
!LAUNCH: ../../vidjil -G ../../germline/TRG -c segment ../../data/segment_lec.fa | grep '^>'
$ Representative first junction Lec
1:>Rep#01.*VJ 0 86 89 118 TRGV5.01 5/CC/0 TRGJ1.02
$ Second junction lec
# 17 22
# | |
# Junc#05: 0 TACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGA
# |||||||||||||||||| ||||||||||||||||||
# V10*02 : 285 TACTACTGTGCTGCGTGGGATTA
# JP1*01 : 0 ATACCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTTCACCTG
1:>Junc#05.*VJ 0 17 22 39 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative second junction Lec
1:>Rep#05.*VJ 0 59 64 114 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative first junction Lec, revcomp
1:>Rep_rc#01 - VJ 0 86 89 118 TRGV5.01 5/CC/0 TRGJ1.02
$ Second junction lec, revcomp
1:>Junc_rc#05 - VJ 0 17 22 39 TRGV10.02 5/AGAC/3 TRGJP1.01
$ Representative second junction Lec, revcomp
1:>Rep_rc#05 - VJ 0 59 64 114 TRGV10.02 5/AGAC/3 TRGJP1.01
>TRGV5*01 5/CC/0 TRGJ1*02 [TRG]
# Representative first junction Lec Rep01
CTCATACACCCAGGAGGTGGAGCTGGATATTGATACTACGAAATCTAATTGAAAATGATTCTGGGGTCTATTACTGTGCCACCTGGGCCTTATTATAAGAAACTCTTTGGCAGTGGAAC
# Representative second junction Lec Rep05
>TRGV10*02 5/AGAC/3 TRGJP1*01 [TRG]
ATCCTTACCATCAAGTCCGTAGAGAAAGAAGACATGGCCGTTTACTACTGTGCTGCGTGGAGACCCACTGGTTGGTTCAAGATATTTGCTGAAGGGACTAAGCTCATAGTAACTT
>Intron -5/CGCCA/-4 KDE [IGK+]
CGTGGCACCGCGAGCTGTAGACAGAGCCGCGGTCTTTCTCGATTGAGTGGCTTTGGTGGCCATGCCACCGCGCTCTTGGGGCAGCCGCCTTGCCGCTAGTGGCCGTGGCCACCCTGTGTCTGCCCGATTAATGCTGCCGTAGCCAGCTTTCCCGCCACCCTAGTGGCAGCCCAGGGCGACTCCTCATGAGTCTGCAGCTGCATTTTTGCCATATCCACTATTTGGAGTCTGACCTCCCTAGGAAGCCTCCCTGCTCCCTAGGACAACCTGCTCTGACCTCTGAGG
\ No newline at end of file
>IGKV1-5*03 -9/4/-1 IGKJ1*01 [IGK]
CTCCTGCTACTCTGGCTCCCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCGTCTGTAGGAGACAGAGTCACCATCACCTGCCGGGCCAGTCAGAGTATTAATAACAACTTGGCCTGGTATCAGGAGAAGCCAGGGAAAGCCCCTAAGGTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACCTATTACTGCCAACAATATAATAGACTTTGGACGTTCGGCCAAGGGACCAAGGTGGAAGTCAAACGAACTGTGGCTGCACCATCT
\ No newline at end of file
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment