Commit 2d5b13d7 authored by Mathieu Giraud's avatar Mathieu Giraud
Browse files

tests: update and add tests

parent bab14096
Pipeline #14541 passed with stages
in 21 seconds
>lcl|FLN1FA002RWEZA.1|
ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
>one mutation here v
ggctggagtgggtttcatagattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
cag
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -w all -g $VIDJIL_DIR/germline/homo-sapiens.g $VIDJIL_DATA/s-somatic.fa ; cat out/s-somatic.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ No clustering due to -w all
2: consider as windows these 2 reads
$ Warning on similar clones in json
1: "code": "W5x", "msg": "Similar to another clone IGHV3-48.01 .* IGHJ4.02"
......@@ -64,4 +64,4 @@ $ All 'start' fields are 1-based, they never equal to zero
0: "start": 0
$ Warning on low coverage
1: "warn": "Low coverage"
1: "code": "W4x", "msg": "Low coverage: 0.442"
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa
!LAUNCH: $VIDJIL_DIR/$EXEC $VIDJIL_DEFAULT_OPTIONS -A -g $VIDJIL_DIR/germline/homo-sapiens.g:IGH $VIDJIL_DATA/toy_V.fa ; cat out/toy_V.vidjil | python $VIDJIL_DIR/tools/format_json.py -1
$ Warning, -A
1:WARNING
$ Warning in json output
1: "code": "W2x", "msg": "Very few V.D.J recombinations found: 0.00."
$ Link to documentation
1:algo.org
......
Markdown is supported
0% or .
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment